Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KDM4B-TPD52L2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KDM4B-TPD52L2
	FusionPDB ID: 41818
	FusionGDB2.0 ID: 41818
		Hgene	Tgene
	Gene symbol	KDM4B	TPD52L2
	Gene ID	23030	7165
	Gene name	lysine demethylase 4B	TPD52 like 2
	Synonyms	JMJD2B\|TDRD14B	D54\|TPD54
	Cytomap	19p13.3	20q13.33
	Type of gene	protein-coding	protein-coding
	Description	lysine-specific demethylase 4BjmjC domain-containing histone demethylation protein 3Bjumonji domain containing 2Bjumonji domain-containing protein 2Blysine (K)-specific demethylase 4Btudor domain containing 14B	tumor protein D54HCCR-binding protein 2tumor protein D52 like 2
	Modification date	20200313	20200313
	UniProtAcc	O94953 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' of histone H3, thereby playing a role in histone code. Does not demethylate histone H3 'Lys-4', H3 'Lys-27', H3 'Lys-36' nor H4 'Lys-20'. Only able to demethylate trimethylated H3 'Lys-9', with a weaker activity than KDM4A, KDM4C and KDM4D. Demethylation of Lys residue generates formaldehyde and succinate. {ECO:0000269\|PubMed:16603238, ECO:0000269\|PubMed:28262558}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000592175, ENST00000159111, ENST00000381759, ENST00000536461,	ENST00000217121, ENST00000346249, ENST00000348257, ENST00000351424, ENST00000352482, ENST00000358548, ENST00000369927,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	30 X 16 X 14=6720	7 X 9 X 5=315
	# samples	38	9
	** MAII score	log2(38/6720*10)=-4.14438990933518 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/315*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KDM4B [Title/Abstract] AND TPD52L2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KDM4B [Title/Abstract] AND TPD52L2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KDM4B(5047680)-TPD52L2(62514072), # samples:1
Anticipated loss of major functional domain due to fusion event.	KDM4B-TPD52L2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-TPD52L2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-TPD52L2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-TPD52L2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KDM4B	GO:0033169	histone H3-K9 demethylation	21914792
Hgene	KDM4B	GO:0070544	histone H3-K36 demethylation	21914792

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:5047680/chr20:62514072)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KDM4B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TPD52L2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000369927	TPD52L2	chr20	62514072	+	1570	844	218	1090	290
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000346249	TPD52L2	chr20	62514072	+	2691	844	218	1090	290
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000348257	TPD52L2	chr20	62514072	+	2691	844	218	1090	290
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000352482	TPD52L2	chr20	62514072	+	2733	844	218	1132	304
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000358548	TPD52L2	chr20	62514072	+	2733	844	218	1132	304
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000351424	TPD52L2	chr20	62514072	+	2760	844	218	1159	313
ENST00000159111	KDM4B	chr19	5047680	+	ENST00000217121	TPD52L2	chr20	62514072	+	2760	844	218	1159	313
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000369927	TPD52L2	chr20	62514072	+	1559	833	207	1079	290
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000346249	TPD52L2	chr20	62514072	+	2680	833	207	1079	290
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000348257	TPD52L2	chr20	62514072	+	2680	833	207	1079	290
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000352482	TPD52L2	chr20	62514072	+	2722	833	207	1121	304
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000358548	TPD52L2	chr20	62514072	+	2722	833	207	1121	304
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000351424	TPD52L2	chr20	62514072	+	2749	833	207	1148	313
ENST00000381759	KDM4B	chr19	5047680	+	ENST00000217121	TPD52L2	chr20	62514072	+	2749	833	207	1148	313
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000369927	TPD52L2	chr20	62514072	+	1392	666	40	912	290
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000346249	TPD52L2	chr20	62514072	+	2513	666	40	912	290
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000348257	TPD52L2	chr20	62514072	+	2513	666	40	912	290
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000352482	TPD52L2	chr20	62514072	+	2555	666	40	954	304
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000358548	TPD52L2	chr20	62514072	+	2555	666	40	954	304
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000351424	TPD52L2	chr20	62514072	+	2582	666	40	981	313
ENST00000536461	KDM4B	chr19	5047680	+	ENST00000217121	TPD52L2	chr20	62514072	+	2582	666	40	981	313

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000159111	ENST00000369927	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.006024198	0.9939758
ENST00000159111	ENST00000346249	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003435577	0.99656445
ENST00000159111	ENST00000348257	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003435577	0.99656445
ENST00000159111	ENST00000352482	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003235225	0.9967648
ENST00000159111	ENST00000358548	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003235225	0.9967648
ENST00000159111	ENST00000351424	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002819454	0.9971806
ENST00000159111	ENST00000217121	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002819454	0.9971806
ENST00000381759	ENST00000369927	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.006124001	0.99387604
ENST00000381759	ENST00000346249	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003599435	0.9964006
ENST00000381759	ENST00000348257	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003599435	0.9964006
ENST00000381759	ENST00000352482	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003300852	0.99669915
ENST00000381759	ENST00000358548	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.003300852	0.99669915
ENST00000381759	ENST00000351424	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002920431	0.9970796
ENST00000381759	ENST00000217121	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002920431	0.9970796
ENST00000536461	ENST00000369927	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.005626446	0.99437356
ENST00000536461	ENST00000346249	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002958769	0.99704117
ENST00000536461	ENST00000348257	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002958769	0.99704117
ENST00000536461	ENST00000352482	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.00294326	0.9970567
ENST00000536461	ENST00000358548	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.00294326	0.9970567
ENST00000536461	ENST00000351424	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002704116	0.9972959
ENST00000536461	ENST00000217121	KDM4B	chr19	5047680	+	TPD52L2	chr20	62514072	+	0.002704116	0.9972959

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KDM4B-TPD52L2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KDM4B	chr19	5047680	TPD52L2	chr20	62514072	666	207	LYSINYLHFGEPKSCYKKTQETLSQA
KDM4B	chr19	5047680	TPD52L2	chr20	62514072	833	207	LYSINYLHFGEPKSCYKKTQETLSQA
KDM4B	chr19	5047680	TPD52L2	chr20	62514072	844	207	LYSINYLHFGEPKSCYKKTQETLSQA

Top

Potential FusionNeoAntigen Information of KDM4B-TPD52L2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KDM4B-TPD52L2_5047680_62514072.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:06	LHFGEPKSC	0.987	0.8854	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:24	LHFGEPKSC	0.9869	0.6482	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:01	LHFGEPKSC	0.9582	0.983	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:02	HFGEPKSCY	0.9008	0.9352	7	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:10	LHFGEPKSC	0.528	0.7317	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:37	LHFGEPKSC	0.2493	0.8472	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:03	LHFGEPKSCY	0.9655	0.8003	6	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:18	LHFGEPKSCY	0.9635	0.7408	6	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:06	YLHFGEPKSC	0.3919	0.8585	5	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:01	YLHFGEPKSCY	0.9999	0.8948	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:25	YLHFGEPKSCY	0.9972	0.8906	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:02	YLHFGEPKSCY	0.9951	0.9039	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:06	NYLHFGEPKSC	0.9388	0.7958	4	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B39:05	LHFGEPKSC	0.942	0.9798	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:21	HFGEPKSCY	0.9041	0.9197	7	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:21	LHFGEPKSCY	0.9559	0.9224	6	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:07	YLHFGEPKSCY	0.9997	0.648	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:09	LHFGEPKSC	0.6025	0.823	6	15
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-C14:03	HFGEPKSCY	0.0308	0.9456	7	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-C14:02	HFGEPKSCY	0.0308	0.9456	7	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B48:02	LHFGEPKSCY	0.9482	0.9278	6	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:54	LHFGEPKSCY	0.9301	0.8908	6	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:33	YLHFGEPKSCY	0.9999	0.8948	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:125	YLHFGEPKSCY	0.9999	0.8948	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:135	YLHFGEPKSCY	0.9999	0.9051	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:27	YLHFGEPKSCY	0.9999	0.9016	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:34	YLHFGEPKSCY	0.9999	0.8948	5	16
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	844	HLA-B15:35	YLHFGEPKSCY	0.9997	0.8789	5	16

Top

Potential FusionNeoAntigen Information of KDM4B-TPD52L2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of KDM4B-TPD52L2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5048	LHFGEPKSCYKKTQ	KDM4B	TPD52L2	chr19	5047680	chr20	62514072	844

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM4B-TPD52L2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5048	LHFGEPKSCYKKTQ	-7.9962	-8.1096
HLA-B14:02	3BVN	5048	LHFGEPKSCYKKTQ	-5.70842	-6.74372
HLA-B52:01	3W39	5048	LHFGEPKSCYKKTQ	-6.83737	-6.95077
HLA-B52:01	3W39	5048	LHFGEPKSCYKKTQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	5048	LHFGEPKSCYKKTQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	5048	LHFGEPKSCYKKTQ	-9.03915	-10.0745
HLA-A24:02	5HGA	5048	LHFGEPKSCYKKTQ	-6.56204	-6.67544
HLA-A24:02	5HGA	5048	LHFGEPKSCYKKTQ	-5.42271	-6.45801
HLA-B44:05	3DX8	5048	LHFGEPKSCYKKTQ	-7.85648	-8.89178
HLA-B44:05	3DX8	5048	LHFGEPKSCYKKTQ	-5.3978	-5.5112
HLA-A02:01	6TDR	5048	LHFGEPKSCYKKTQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KDM4B-TPD52L2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	4	15	NYLHFGEPKSC	CCTGCACTTTGGGGAGCCTAAGTCCTGCTACAA
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	5	15	YLHFGEPKSC	GCACTTTGGGGAGCCTAAGTCCTGCTACAA
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	5	16	YLHFGEPKSCY	GCACTTTGGGGAGCCTAAGTCCTGCTACAAGAA
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	6	15	LHFGEPKSC	CTTTGGGGAGCCTAAGTCCTGCTACAA
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	6	16	LHFGEPKSCY	CTTTGGGGAGCCTAAGTCCTGCTACAAGAA
KDM4B-TPD52L2	chr19	5047680	chr20	62514072	7	16	HFGEPKSCY	TGGGGAGCCTAAGTCCTGCTACAAGAA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of KDM4B-TPD52L2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	KDM4B-TPD52L2	chr19	5047680	ENST00000159111	chr20	62514072	ENST00000217121	TCGA-IP-7968-11A

Top

Potential target of CAR-T therapy development for KDM4B-TPD52L2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KDM4B-TPD52L2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KDM4B-TPD52L2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)