![]() |
|||||||
|
Fusion Protein:KDM5A-RAE1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: KDM5A-RAE1 | FusionPDB ID: 41856 | FusionGDB2.0 ID: 41856 | Hgene | Tgene | Gene symbol | KDM5A | RAE1 | Gene ID | 5927 | 84659 |
Gene name | lysine demethylase 5A | ribonuclease A family member 7 | |
Synonyms | RBBP-2|RBBP2|RBP2 | RAE1 | |
Cytomap | 12p13.33 | 14q11.2 | |
Type of gene | protein-coding | protein-coding | |
Description | lysine-specific demethylase 5AJumonji, AT rich interactive domain 1A (RBP2-like)histone demethylase JARID1Ajumonji/ARID domain-containing protein 1Alysine (K)-specific demethylase 5Aretinoblastoma binding protein 2 | ribonuclease 7RNase 7SAP-2ribonuclease, RNase A family, 7skin-derived antimicrobial protein 2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | P29375 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-4' of histone H3, thereby playing a central role in histone code. Does not demethylate histone H3 'Lys-9', H3 'Lys-27', H3 'Lys-36', H3 'Lys-79' or H4 'Lys-20'. Demethylates trimethylated and dimethylated but not monomethylated H3 'Lys-4'. Regulates specific gene transcription through DNA-binding on 5'-CCGCCC-3' motif (PubMed:18270511). May stimulate transcription mediated by nuclear receptors. Involved in transcriptional regulation of Hox proteins during cell differentiation (PubMed:19430464). May participate in transcriptional repression of cytokines such as CXCL12. Plays a role in the regulation of the circadian rhythm and in maintaining the normal periodicity of the circadian clock. In a histone demethylase-independent manner, acts as a coactivator of the CLOCK-ARNTL/BMAL1-mediated transcriptional activation of PER1/2 and other clock-controlled genes and increases histone acetylation at PER1/2 promoters by inhibiting the activity of HDAC1 (By similarity). Seems to act as a transcriptional corepressor for some genes such as MT1F and to favor the proliferation of cancer cells (PubMed:27427228). {ECO:0000250|UniProtKB:Q3UXZ9, ECO:0000269|PubMed:11358960, ECO:0000269|PubMed:15949438, ECO:0000269|PubMed:17320160, ECO:0000269|PubMed:17320161, ECO:0000269|PubMed:17320163, ECO:0000269|PubMed:18270511, ECO:0000269|PubMed:19430464, ECO:0000269|PubMed:27427228}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000382815, ENST00000399788, ENST00000540838, | ENST00000371242, ENST00000395840, ENST00000395841, ENST00000527947, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 11 X 15 X 6=990 | 9 X 11 X 5=495 |
# samples | 18 | 10 | |
** MAII score | log2(18/990*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/495*10)=-2.30742852519225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: KDM5A [Title/Abstract] AND RAE1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: KDM5A [Title/Abstract] AND RAE1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | KDM5A(459787)-RAE1(55940412), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | KDM5A-RAE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5A-RAE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5A-RAE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5A-RAE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | KDM5A | GO:0034720 | histone H3-K4 demethylation | 18270511 |
Hgene | KDM5A | GO:0045893 | positive regulation of transcription, DNA-templated | 11358960 |
Tgene | RAE1 | GO:0019731 | antibacterial humoral response | 23302724|25075772 |
Tgene | RAE1 | GO:0045087 | innate immune response | 16940129|23302724|25075772 |
Tgene | RAE1 | GO:0050829 | defense response to Gram-negative bacterium | 12244054|16940129|20180804|23302724|25075772 |
Tgene | RAE1 | GO:0050830 | defense response to Gram-positive bacterium | 12244054|16940129|19641608|20180804|23302724|25075772 |
Tgene | RAE1 | GO:0050832 | defense response to fungus | 12244054 |
Tgene | RAE1 | GO:0051673 | membrane disruption in other organism | 20180804|23302724 |
Tgene | RAE1 | GO:0061844 | antimicrobial humoral immune response mediated by antimicrobial peptide | 12244054|25075772 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:459787/chr20:55940412) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000399788 | KDM5A | chr12 | 459787 | - | ENST00000395841 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000399788 | KDM5A | chr12 | 459787 | - | ENST00000371242 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000399788 | KDM5A | chr12 | 459787 | - | ENST00000527947 | RAE1 | chr20 | 55940412 | + | 2708 | 1671 | 363 | 2696 | 777 |
ENST00000399788 | KDM5A | chr12 | 459787 | - | ENST00000395840 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459787 | - | ENST00000395841 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459787 | - | ENST00000371242 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459787 | - | ENST00000527947 | RAE1 | chr20 | 55940412 | + | 2708 | 1671 | 363 | 2696 | 777 |
ENST00000382815 | KDM5A | chr12 | 459787 | - | ENST00000395840 | RAE1 | chr20 | 55940412 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000399788 | KDM5A | chr12 | 459786 | - | ENST00000395841 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000399788 | KDM5A | chr12 | 459786 | - | ENST00000371242 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000399788 | KDM5A | chr12 | 459786 | - | ENST00000527947 | RAE1 | chr20 | 55940411 | + | 2708 | 1671 | 363 | 2696 | 777 |
ENST00000399788 | KDM5A | chr12 | 459786 | - | ENST00000395840 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459786 | - | ENST00000395841 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459786 | - | ENST00000371242 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
ENST00000382815 | KDM5A | chr12 | 459786 | - | ENST00000527947 | RAE1 | chr20 | 55940411 | + | 2708 | 1671 | 363 | 2696 | 777 |
ENST00000382815 | KDM5A | chr12 | 459786 | - | ENST00000395840 | RAE1 | chr20 | 55940411 | + | 3602 | 1671 | 363 | 2489 | 708 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000399788 | ENST00000395841 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000399788 | ENST00000371242 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000399788 | ENST00000527947 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.002473141 | 0.9975268 |
ENST00000399788 | ENST00000395840 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000395841 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000371242 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000527947 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.002473141 | 0.9975268 |
ENST00000382815 | ENST00000395840 | KDM5A | chr12 | 459787 | - | RAE1 | chr20 | 55940412 | + | 0.001377645 | 0.9986224 |
ENST00000399788 | ENST00000395841 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
ENST00000399788 | ENST00000371242 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
ENST00000399788 | ENST00000527947 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.002473141 | 0.9975268 |
ENST00000399788 | ENST00000395840 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000395841 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000371242 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
ENST00000382815 | ENST00000527947 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.002473141 | 0.9975268 |
ENST00000382815 | ENST00000395840 | KDM5A | chr12 | 459786 | - | RAE1 | chr20 | 55940411 | + | 0.001377645 | 0.9986224 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for KDM5A-RAE1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
KDM5A | chr12 | 459786 | RAE1 | chr20 | 55940411 | 1671 | 426 | SSKDFGSGFPVKDGRRKILPEEEDGS |
KDM5A | chr12 | 459787 | RAE1 | chr20 | 55940412 | 1671 | 426 | SSKDFGSGFPVKDGRRKILPEEEDGS |
Top |
Potential FusionNeoAntigen Information of KDM5A-RAE1 in HLA I |
![]() |
KDM5A-RAE1_459786_55940411.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B35:03 | FPVKDGRRKIL | 0.9277 | 0.8437 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B35:02 | FPVKDGRRKIL | 0.8615 | 0.8773 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B35:04 | FPVKDGRRKIL | 0.8615 | 0.8773 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B14:03 | VKDGRRKIL | 0.2361 | 0.5187 | 10 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B07:12 | FPVKDGRRKIL | 0.9818 | 0.5457 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B35:12 | FPVKDGRRKIL | 0.8615 | 0.8773 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B39:10 | FPVKDGRRKIL | 0.7872 | 0.7316 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-C07:04 | VKDGRRKIL | 0.1867 | 0.8433 | 10 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B35:09 | FPVKDGRRKIL | 0.8615 | 0.8773 | 8 | 19 |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 | HLA-B67:01 | FPVKDGRRKIL | 0.8395 | 0.5552 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of KDM5A-RAE1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of KDM5A-RAE1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8586 | SGFPVKDGRRKILP | KDM5A | RAE1 | chr12 | 459786 | chr20 | 55940411 | 1671 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM5A-RAE1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8586 | SGFPVKDGRRKILP | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 8586 | SGFPVKDGRRKILP | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 8586 | SGFPVKDGRRKILP | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 8586 | SGFPVKDGRRKILP | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 8586 | SGFPVKDGRRKILP | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 8586 | SGFPVKDGRRKILP | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 8586 | SGFPVKDGRRKILP | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 8586 | SGFPVKDGRRKILP | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 8586 | SGFPVKDGRRKILP | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 8586 | SGFPVKDGRRKILP | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 8586 | SGFPVKDGRRKILP | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of KDM5A-RAE1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 10 | 19 | VKDGRRKIL | GAAGAAGAGGATGGGAGCAAAGTGTTT |
KDM5A-RAE1 | chr12 | 459786 | chr20 | 55940411 | 8 | 19 | FPVKDGRRKIL | CTGCCAGAAGAAGAGGATGGGAGCAAAGTGTTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of KDM5A-RAE1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | KDM5A-RAE1 | chr12 | 459786 | ENST00000382815 | chr20 | 55940411 | ENST00000371242 | TCGA-44-A47B |
Top |
Potential target of CAR-T therapy development for KDM5A-RAE1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to KDM5A-RAE1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to KDM5A-RAE1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |