Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KDM5B-RASAL2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KDM5B-RASAL2
	FusionPDB ID: 41869
	FusionGDB2.0 ID: 41869
		Hgene	Tgene
	Gene symbol	KDM5B	RASAL2
	Gene ID	10765	9462
	Gene name	lysine demethylase 5B	RAS protein activator like 2
	Synonyms	CT31\|JARID1B\|MRT65\|PLU-1\|PLU1\|PPP1R98\|PUT1\|RBBP2H1A\|RBP2-H1	NGAP
	Cytomap	1q32.1	1q25.2
	Type of gene	protein-coding	protein-coding
	Description	lysine-specific demethylase 5Bcancer/testis antigen 31histone demethylase JARID1Bjumonji, AT rich interactive domain 1Bjumonji/ARID domain-containing protein 1Blysine (K)-specific demethylase 5Bprotein phosphatase 1, regulatory subunit 98putative D	ras GTPase-activating protein nGAPRASAL2/ACVR1 fusionRas protein activator like 1
	Modification date	20200320	20200313
	UniProtAcc	Q9UGL1 Main function of 5'-partner protein: FUNCTION: Histone demethylase that demethylates 'Lys-4' of histone H3, thereby playing a central role in histone code (PubMed:24952722, PubMed:27214403, PubMed:28262558). Does not demethylate histone H3 'Lys-9' or H3 'Lys-27'. Demethylates trimethylated, dimethylated and monomethylated H3 'Lys-4'. Acts as a transcriptional corepressor for FOXG1B and PAX9. Favors the proliferation of breast cancer cells by repressing tumor suppressor genes such as BRCA1 and HOXA5 (PubMed:24952722). In contrast, may act as a tumor suppressor for melanoma. Represses the CLOCK-ARNTL/BMAL1 heterodimer-mediated transcriptional activation of the core clock component PER2 (By similarity). {ECO:0000250\|UniProtKB:Q80Y84, ECO:0000269\|PubMed:12657635, ECO:0000269\|PubMed:16645588, ECO:0000269\|PubMed:17320161, ECO:0000269\|PubMed:17363312, ECO:0000269\|PubMed:24952722, ECO:0000269\|PubMed:26645689, ECO:0000269\|PubMed:26741168, ECO:0000269\|PubMed:27214403, ECO:0000269\|PubMed:28262558}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000367264, ENST00000367265, ENST00000456180,	ENST00000462775, ENST00000465723, ENST00000367649, ENST00000448150,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 13 X 9=1638	15 X 14 X 7=1470
	# samples	17	19
	** MAII score	log2(17/1638*10)=-3.26832870550331 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/1470*10)=-2.95174483139278 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KDM5B [Title/Abstract] AND RASAL2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KDM5B [Title/Abstract] AND RASAL2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KDM5B(202777230)-RASAL2(178389646), # samples:2
Anticipated loss of major functional domain due to fusion event.	KDM5B-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5B-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5B-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5B-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KDM5B	GO:0034720	histone H3-K4 demethylation	20228790

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:202777230/chr1:178389646)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KDM5B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RASAL2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367265	KDM5B	chr1	202777230	-	ENST00000448150	RASAL2	chr1	178389646	+	10939	1369	934	4668	1244
ENST00000367265	KDM5B	chr1	202777230	-	ENST00000367649	RASAL2	chr1	178389646	+	4831	1369	934	4647	1237
ENST00000367264	KDM5B	chr1	202777230	-	ENST00000448150	RASAL2	chr1	178389646	+	9887	317	113	3616	1167
ENST00000367264	KDM5B	chr1	202777230	-	ENST00000367649	RASAL2	chr1	178389646	+	3779	317	113	3595	1160

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367265	ENST00000448150	KDM5B	chr1	202777230	-	RASAL2	chr1	178389646	+	0.000643022	0.9993569
ENST00000367265	ENST00000367649	KDM5B	chr1	202777230	-	RASAL2	chr1	178389646	+	0.003027692	0.9969723
ENST00000367264	ENST00000448150	KDM5B	chr1	202777230	-	RASAL2	chr1	178389646	+	0.000224248	0.9997757
ENST00000367264	ENST00000367649	KDM5B	chr1	202777230	-	RASAL2	chr1	178389646	+	0.001999508	0.99800044

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KDM5B-RASAL2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KDM5B	chr1	202777230	RASAL2	chr1	178389646	1369	145	AEQTGICKVRPPPGFFSKRLKGSIKR
KDM5B	chr1	202777230	RASAL2	chr1	178389646	317	68	AEQTGICKVRPPPGFFSKRLKGSIKR

Top

Potential FusionNeoAntigen Information of KDM5B-RASAL2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KDM5B-RASAL2_202777230_178389646.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:01	KVRPPPGFF	0.9908	0.8403	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B57:01	KVRPPPGFF	0.9905	0.9099	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:17	KVRPPPGFF	0.985	0.8429	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:25	KVRPPPGFF	0.9808	0.89	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:16	KVRPPPGFF	0.979	0.7006	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B58:02	KVRPPPGFF	0.9748	0.8621	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B57:03	KVRPPPGFF	0.9711	0.9302	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:08	KVRPPPGFF	0.8792	0.7294	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A32:13	KVRPPPGFF	0.8265	0.9368	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:08	KVRPPPGFFS	0.9882	0.8121	7	17
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:08	KVRPPPGFFSK	0.9999	0.7484	7	18
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:95	VRPPPGFF	0.9996	0.7053	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:05	VRPPPGFF	0.9995	0.9497	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:27	VRPPPGFF	0.9991	0.9556	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:29	VRPPPGFF	0.9982	0.9063	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:46	VRPPPGFF	0.9979	0.9179	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:19	VRPPPGFF	0.9975	0.7973	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:13	VRPPPGFF	0.9955	0.8927	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:67	VRPPPGFF	0.995	0.959	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:80	VRPPPGFF	0.995	0.959	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:10	VRPPPGFF	0.994	0.9594	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C12:16	VRPPPGFF	0.9716	0.9624	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:07	KVRPPPGFF	0.9863	0.602	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:04	KVRPPPGFF	0.9569	0.8553	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C15:04	KVRPPPGFF	0.7932	0.8843	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C15:06	KVRPPPGFF	0.4902	0.8798	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C12:12	KVRPPPGFF	0.4821	0.8873	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C03:14	KVRPPPGFF	0.4803	0.9529	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C12:04	KVRPPPGFF	0.3393	0.9933	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C06:03	KVRPPPGFF	0.3261	0.9898	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B27:14	VRPPPGFFSK	0.9973	0.6373	8	18
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B07:12	RPPPGFFSKRL	0.9972	0.5626	9	20
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B42:02	RPPPGFFSKRL	0.9466	0.6262	9	20
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B42:01	RPPPGFFSKRL	0.9266	0.6185	9	20
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:01	VRPPPGFF	0.9997	0.686	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:22	VRPPPGFF	0.9994	0.7191	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:17	VRPPPGFF	0.9992	0.9664	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:02	VRPPPGFF	0.995	0.959	8	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:01	KVRPPPGF	0.9634	0.7923	7	15
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:135	KVRPPPGFF	0.9916	0.8666	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:125	KVRPPPGFF	0.9908	0.8403	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:33	KVRPPPGFF	0.9908	0.8403	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:27	KVRPPPGFF	0.9908	0.8456	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:34	KVRPPPGFF	0.9908	0.8403	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B57:10	KVRPPPGFF	0.9905	0.9099	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:24	KVRPPPGFF	0.9881	0.8654	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A32:01	KVRPPPGFF	0.9867	0.9238	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B58:06	KVRPPPGFF	0.9829	0.8152	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:39	KVRPPPGFF	0.9801	0.7855	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:35	KVRPPPGFF	0.9801	0.8377	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B57:04	KVRPPPGFF	0.9773	0.6671	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:50	KVRPPPGFF	0.9646	0.8492	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:13	KVRPPPGFF	0.9574	0.6487	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:12	KVRPPPGFF	0.9101	0.8005	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:01	KVRPPPGFF	0.9016	0.8297	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B57:02	KVRPPPGFF	0.9	0.8662	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B07:13	KVRPPPGFF	0.8781	0.7876	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:54	KVRPPPGFF	0.8373	0.7874	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C15:09	KVRPPPGFF	0.7932	0.8843	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:68	KVRPPPGFF	0.7679	0.5136	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C03:02	KVRPPPGFF	0.7491	0.9669	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C07:01	KVRPPPGFF	0.6667	0.5517	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C02:02	KVRPPPGFF	0.6553	0.9703	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C02:10	KVRPPPGFF	0.6553	0.9703	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C16:04	KVRPPPGFF	0.6487	0.9705	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C12:03	KVRPPPGFF	0.5462	0.9745	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C12:02	KVRPPPGFF	0.5155	0.9549	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-B15:30	KVRPPPGFF	0.4918	0.8779	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C15:05	KVRPPPGFF	0.3918	0.8861	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-C16:02	KVRPPPGFF	0.3029	0.9919	7	16
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:01	KVRPPPGFFS	0.9901	0.8768	7	17
KDM5B-RASAL2	chr1	202777230	chr1	178389646	317	HLA-A30:01	KVRPPPGFFSK	0.9999	0.7946	7	18

Top

Potential FusionNeoAntigen Information of KDM5B-RASAL2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of KDM5B-RASAL2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
857	CKVRPPPGFFSKRL	KDM5B	RASAL2	chr1	202777230	chr1	178389646	317

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM5B-RASAL2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	857	CKVRPPPGFFSKRL	-8.62545	-8.73885
HLA-B14:02	3BVN	857	CKVRPPPGFFSKRL	-3.26321	-4.29851
HLA-B52:01	3W39	857	CKVRPPPGFFSKRL	-6.23413	-6.34753
HLA-B52:01	3W39	857	CKVRPPPGFFSKRL	-4.55402	-5.58932
HLA-A24:02	5HGA	857	CKVRPPPGFFSKRL	-8.62578	-8.73918
HLA-A24:02	5HGA	857	CKVRPPPGFFSKRL	-6.438	-7.4733
HLA-B44:05	3DX8	857	CKVRPPPGFFSKRL	-5.68484	-5.79824
HLA-B44:05	3DX8	857	CKVRPPPGFFSKRL	-3.64855	-4.68385
HLA-A02:01	6TDR	857	CKVRPPPGFFSKRL	-5.14764	-6.18294

Top

Vaccine Design for the FusionNeoAntigens of KDM5B-RASAL2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KDM5B-RASAL2	chr1	202777230	chr1	178389646	7	15	KVRPPPGF	AAGGTGCGGCCGCCGCCGGGATTC
KDM5B-RASAL2	chr1	202777230	chr1	178389646	7	16	KVRPPPGFF	AAGGTGCGGCCGCCGCCGGGATTCTTC
KDM5B-RASAL2	chr1	202777230	chr1	178389646	7	17	KVRPPPGFFS	AAGGTGCGGCCGCCGCCGGGATTCTTCAGC
KDM5B-RASAL2	chr1	202777230	chr1	178389646	7	18	KVRPPPGFFSK	AAGGTGCGGCCGCCGCCGGGATTCTTCAGCAAG
KDM5B-RASAL2	chr1	202777230	chr1	178389646	8	16	VRPPPGFF	GTGCGGCCGCCGCCGGGATTCTTC
KDM5B-RASAL2	chr1	202777230	chr1	178389646	8	18	VRPPPGFFSK	GTGCGGCCGCCGCCGGGATTCTTCAGCAAG
KDM5B-RASAL2	chr1	202777230	chr1	178389646	9	20	RPPPGFFSKRL	CGGCCGCCGCCGGGATTCTTCAGCAAGCGCCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of KDM5B-RASAL2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	KDM5B-RASAL2	chr1	202777230	ENST00000367264	chr1	178389646	ENST00000367649	TCGA-EE-A3J5-06A

Top

Potential target of CAR-T therapy development for KDM5B-RASAL2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KDM5B-RASAL2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KDM5B-RASAL2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)