|
|||||||
|
Fusion Protein:KDM5C-HSD17B10 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: KDM5C-HSD17B10 | FusionPDB ID: 41879 | FusionGDB2.0 ID: 41879 | Hgene | Tgene | Gene symbol | KDM5C | HSD17B10 | Gene ID | 8242 | 3028 |
| Gene name | lysine demethylase 5C | hydroxysteroid 17-beta dehydrogenase 10 | |
| Synonyms | DXS1272E|JARID1C|MRX13|MRXJ|MRXSCJ|MRXSJ|SMCX|XE169 | 17b-HSD10|ABAD|CAMR|DUPXp11.22|ERAB|HADH2|HCD2|HSD10MD|MHBD|MRPP2|MRX17|MRX31|MRXS10|SCHAD|SDR5C1 | |
| Cytomap | Xp11.22 | Xp11.22 | |
| Type of gene | protein-coding | protein-coding | |
| Description | lysine-specific demethylase 5CJmjC domain-containing protein SMCXJumonji, AT rich interactive domain 1C (RBP2-like)Jumonji/ARID domain-containing protein 1CSmcx homolog, X chromosomeSmcy homolog, X-linkedhistone demethylase JARID1Clysine (K)-specif | 3-hydroxyacyl-CoA dehydrogenase type-23-hydroxy-2-methylbutyryl-CoA dehydrogenaseAB-binding alcohol dehydrogenaseamyloid-beta peptide binding alcohol dehydrogenaseendoplasmic reticulum-associated amyloid beta-peptide-binding proteinmitochondrial RNas | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | P41229 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-4' of histone H3, thereby playing a central role in histone code (PubMed:28262558). Does not demethylate histone H3 'Lys-9', H3 'Lys-27', H3 'Lys-36', H3 'Lys-79' or H4 'Lys-20'. Demethylates trimethylated and dimethylated but not monomethylated H3 'Lys-4'. Participates in transcriptional repression of neuronal genes by recruiting histone deacetylases and REST at neuron-restrictive silencer elements. Represses the CLOCK-ARNTL/BMAL1 heterodimer-mediated transcriptional activation of the core clock component PER2 (By similarity). {ECO:0000250|UniProtKB:P41230, ECO:0000269|PubMed:17320160, ECO:0000269|PubMed:17320161, ECO:0000269|PubMed:17468742, ECO:0000269|PubMed:26645689, ECO:0000269|PubMed:28262558}. | Q99714 Main function of 5'-partner protein: FUNCTION: Mitochondrial dehydrogenase involved in pathways of fatty acid, branched-chain amino acid and steroid metabolism (PubMed:9553139, PubMed:10600649, PubMed:12917011, PubMed:20077426, PubMed:18996107, PubMed:19706438, PubMed:25925575, PubMed:26950678, PubMed:28888424). Acts as (S)-3-hydroxyacyl-CoA dehydrogenase in mitochondrial fatty acid beta-oxidation, a major degradation pathway of fatty acids. Catalyzes the third step in the beta-oxidation cycle, namely the reversible conversion of (S)-3-hydroxyacyl-CoA to 3-ketoacyl-CoA. Preferentially accepts straight medium- and short-chain acyl-CoA substrates with highest efficiency for (3S)-hydroxybutanoyl-CoA (PubMed:9553139, PubMed:10600649, PubMed:12917011, PubMed:25925575, PubMed:26950678). Acts as 3-hydroxy-2-methylbutyryl-CoA dehydrogenase in branched-chain amino acid catabolic pathway. Catalyzes the oxidation of 3-hydroxy-2-methylbutanoyl-CoA into 2-methyl-3-oxobutanoyl-CoA, a step in isoleucine degradation pathway (PubMed:20077426, PubMed:18996107, PubMed:19706438). Has hydroxysteroid dehydrogenase activity toward steroid hormones and bile acids. Catalyzes the oxidation of 3alpha-, 17beta-, 20beta- and 21-hydroxysteroids and 7alpha- and 7beta-hydroxy bile acids (PubMed:10600649, PubMed:12917011). Oxidizes allopregnanolone/brexanolone at the 3alpha-hydroxyl group, which is known to be critical for the activation of gamma-aminobutyric acid receptors (GABAARs) chloride channel (PubMed:19706438, PubMed:28888424). Has phospholipase C-like activity toward cardiolipin and its oxidized species. Likely oxidizes the 2'-hydroxyl in the head group of cardiolipin to form a ketone intermediate that undergoes nucleophilic attack by water and fragments into diacylglycerol, dihydroxyacetone and orthophosphate. Has higher affinity for cardiolipin with oxidized fatty acids and may degrade these species during the oxidative stress response to protect cells from apoptosis (PubMed:26338420). By interacting with intracellular amyloid-beta, it may contribute to the neuronal dysfunction associated with Alzheimer disease (AD) (PubMed:9338779). Essential for structural and functional integrity of mitochondria (PubMed:20077426). {ECO:0000269|PubMed:10600649, ECO:0000269|PubMed:12917011, ECO:0000269|PubMed:18996107, ECO:0000269|PubMed:19706438, ECO:0000269|PubMed:20077426, ECO:0000269|PubMed:25925575, ECO:0000269|PubMed:26338420, ECO:0000269|PubMed:26950678, ECO:0000269|PubMed:28888424, ECO:0000269|PubMed:9553139}.; FUNCTION: In addition to mitochondrial dehydrogenase activity, moonlights as a component of mitochondrial ribonuclease P, a complex that cleaves tRNA molecules in their 5'-ends (PubMed:18984158, PubMed:24549042, PubMed:25925575, PubMed:26950678, PubMed:28888424). Together with TRMT10C/MRPP1, forms a subcomplex of the mitochondrial ribonuclease P, named MRPP1-MRPP2 subcomplex, which displays functions that are independent of the ribonuclease P activity (PubMed:23042678, PubMed:29040705). The MRPP1-MRPP2 subcomplex catalyzes the formation of N(1)-methylguanine and N(1)-methyladenine at position 9 (m1G9 and m1A9, respectively) in tRNAs; HSD17B10/MRPP2 acting as a non-catalytic subunit (PubMed:23042678, PubMed:25925575, PubMed:28888424). The MRPP1-MRPP2 subcomplex also acts as a tRNA maturation platform: following 5'-end cleavage by the mitochondrial ribonuclease P complex, the MRPP1-MRPP2 subcomplex enhances the efficiency of 3'-processing catalyzed by ELAC2, retains the tRNA product after ELAC2 processing and presents the nascent tRNA to the mitochondrial CCA tRNA nucleotidyltransferase TRNT1 enzyme (PubMed:29040705). Associates with mitochondrial DNA complexes at the nucleoids to initiate RNA processing and ribosome assembly. {ECO:0000269|PubMed:18984158, ECO:0000269|PubMed:23042678, ECO:0000269|PubMed:24549042, ECO:0000269|PubMed:24703694, ECO:0000269|PubMed:25925575, ECO:0000269|PubMed:26950678, ECO:0000269|PubMed:28888424, ECO:0000269|PubMed:29040705}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000375379, ENST00000375383, ENST00000375401, ENST00000404049, ENST00000452825, ENST00000465402, | ENST00000495986, ENST00000168216, ENST00000375298, ENST00000375304, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 17 X 19 X 7=2261 | 2 X 2 X 2=8 |
| # samples | 18 | 3 | |
| ** MAII score | log2(18/2261*10)=-3.65089218042185 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/8*10)=1.90689059560852 | |
| Fusion gene context | PubMed: KDM5C [Title/Abstract] AND HSD17B10 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: KDM5C [Title/Abstract] AND HSD17B10 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | KDM5C(53246325)-HSD17B10(53459359), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | KDM5C-HSD17B10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5C-HSD17B10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5C-HSD17B10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM5C-HSD17B10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | KDM5C | GO:0034720 | histone H3-K4 demethylation | 17320160 |
| Tgene | HSD17B10 | GO:0051289 | protein homotetramerization | 25925575 |
| Tgene | HSD17B10 | GO:0070901 | mitochondrial tRNA methylation | 25925575|28888424 |
| Tgene | HSD17B10 | GO:0097745 | mitochondrial tRNA 5'-end processing | 24549042|25925575|28888424|29040705 |
| Tgene | HSD17B10 | GO:1990180 | mitochondrial tRNA 3'-end processing | 29040705 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:53246325/chrX:53459359) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across KDM5C (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across HSD17B10 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000452825 | KDM5C | chrX | 53246325 | - | ENST00000375304 | HSD17B10 | chrX | 53459359 | - | 1702 | 989 | 533 | 1555 | 340 |
| ENST00000452825 | KDM5C | chrX | 53246325 | - | ENST00000168216 | HSD17B10 | chrX | 53459359 | - | 1729 | 989 | 533 | 1582 | 349 |
| ENST00000452825 | KDM5C | chrX | 53246325 | - | ENST00000375298 | HSD17B10 | chrX | 53459359 | - | 1615 | 989 | 533 | 1306 | 257 |
| ENST00000375401 | KDM5C | chrX | 53246325 | - | ENST00000375304 | HSD17B10 | chrX | 53459359 | - | 1903 | 1190 | 533 | 1756 | 407 |
| ENST00000375401 | KDM5C | chrX | 53246325 | - | ENST00000168216 | HSD17B10 | chrX | 53459359 | - | 1930 | 1190 | 533 | 1783 | 416 |
| ENST00000375401 | KDM5C | chrX | 53246325 | - | ENST00000375298 | HSD17B10 | chrX | 53459359 | - | 1816 | 1190 | 533 | 1507 | 324 |
| ENST00000404049 | KDM5C | chrX | 53246325 | - | ENST00000375304 | HSD17B10 | chrX | 53459359 | - | 1654 | 941 | 287 | 1507 | 406 |
| ENST00000404049 | KDM5C | chrX | 53246325 | - | ENST00000168216 | HSD17B10 | chrX | 53459359 | - | 1681 | 941 | 287 | 1534 | 415 |
| ENST00000404049 | KDM5C | chrX | 53246325 | - | ENST00000375298 | HSD17B10 | chrX | 53459359 | - | 1567 | 941 | 287 | 1258 | 323 |
| ENST00000375379 | KDM5C | chrX | 53246325 | - | ENST00000375304 | HSD17B10 | chrX | 53459359 | - | 1903 | 1190 | 533 | 1756 | 407 |
| ENST00000375379 | KDM5C | chrX | 53246325 | - | ENST00000168216 | HSD17B10 | chrX | 53459359 | - | 1930 | 1190 | 533 | 1783 | 416 |
| ENST00000375379 | KDM5C | chrX | 53246325 | - | ENST00000375298 | HSD17B10 | chrX | 53459359 | - | 1816 | 1190 | 533 | 1507 | 324 |
| ENST00000375383 | KDM5C | chrX | 53246325 | - | ENST00000375304 | HSD17B10 | chrX | 53459359 | - | 1780 | 1067 | 533 | 1633 | 366 |
| ENST00000375383 | KDM5C | chrX | 53246325 | - | ENST00000168216 | HSD17B10 | chrX | 53459359 | - | 1807 | 1067 | 533 | 1660 | 375 |
| ENST00000375383 | KDM5C | chrX | 53246325 | - | ENST00000375298 | HSD17B10 | chrX | 53459359 | - | 1693 | 1067 | 533 | 1384 | 283 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000452825 | ENST00000375304 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001787673 | 0.99821234 |
| ENST00000452825 | ENST00000168216 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001733699 | 0.9982663 |
| ENST00000452825 | ENST00000375298 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.004043282 | 0.9959567 |
| ENST00000375401 | ENST00000375304 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001388821 | 0.9986112 |
| ENST00000375401 | ENST00000168216 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001293836 | 0.9987061 |
| ENST00000375401 | ENST00000375298 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001138964 | 0.9988611 |
| ENST00000404049 | ENST00000375304 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001670828 | 0.9983292 |
| ENST00000404049 | ENST00000168216 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001746583 | 0.9982534 |
| ENST00000404049 | ENST00000375298 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001287264 | 0.9987128 |
| ENST00000375379 | ENST00000375304 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001388821 | 0.9986112 |
| ENST00000375379 | ENST00000168216 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001293836 | 0.9987061 |
| ENST00000375379 | ENST00000375298 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.001138964 | 0.9988611 |
| ENST00000375383 | ENST00000375304 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.002213219 | 0.99778676 |
| ENST00000375383 | ENST00000168216 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.002785083 | 0.9972149 |
| ENST00000375383 | ENST00000375298 | KDM5C | chrX | 53246325 | - | HSD17B10 | chrX | 53459359 | - | 0.003261814 | 0.99673814 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for KDM5C-HSD17B10 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| KDM5C | chrX | 53246325 | HSD17B10 | chrX | 53459359 | 1067 | 178 | NSYGRRAKRLQPDVTSEKDVQTALAL |
| KDM5C | chrX | 53246325 | HSD17B10 | chrX | 53459359 | 1190 | 219 | NSYGRRAKRLQPDVTSEKDVQTALAL |
| KDM5C | chrX | 53246325 | HSD17B10 | chrX | 53459359 | 941 | 218 | NSYGRRAKRLQPDVTSEKDVQTALAL |
| KDM5C | chrX | 53246325 | HSD17B10 | chrX | 53459359 | 989 | 152 | NSYGRRAKRLQPDVTSEKDVQTALAL |
Top |
Potential FusionNeoAntigen Information of KDM5C-HSD17B10 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| KDM5C-HSD17B10_53246325_53459359.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | HLA-A30:08 | RLQPDVTSEK | 0.9923 | 0.8033 | 8 | 18 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | HLA-B27:14 | KRLQPDVTS | 0.987 | 0.5762 | 7 | 16 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | HLA-B27:03 | KRLQPDVTSEK | 0.9988 | 0.5143 | 7 | 18 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | HLA-A30:01 | RLQPDVTSEK | 0.992 | 0.9103 | 8 | 18 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | HLA-B27:10 | KRLQPDVTSEK | 0.9999 | 0.7892 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of KDM5C-HSD17B10 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| KDM5C-HSD17B10_53246325_53459359.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0301 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0301 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0313 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0313 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0315 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0315 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0318 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0318 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0320 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0320 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0322 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0322 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0326 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0326 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0328 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0328 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0330 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0330 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0332 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0332 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0334 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0334 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0336 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0336 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0342 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0342 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0344 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0344 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0346 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0346 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0348 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0348 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0350 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0350 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0352 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0352 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0354 | AKRLQPDVTSEKDVQ | 6 | 21 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0354 | RAKRLQPDVTSEKDV | 5 | 20 |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 | DRB1-0422 | AKRLQPDVTSEKDVQ | 6 | 21 |
Top |
Fusion breakpoint peptide structures of KDM5C-HSD17B10 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 325 | AKRLQPDVTSEKDV | KDM5C | HSD17B10 | chrX | 53246325 | chrX | 53459359 | 1190 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM5C-HSD17B10 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 325 | AKRLQPDVTSEKDV | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 325 | AKRLQPDVTSEKDV | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 325 | AKRLQPDVTSEKDV | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 325 | AKRLQPDVTSEKDV | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 325 | AKRLQPDVTSEKDV | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 325 | AKRLQPDVTSEKDV | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 325 | AKRLQPDVTSEKDV | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 325 | AKRLQPDVTSEKDV | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 325 | AKRLQPDVTSEKDV | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 325 | AKRLQPDVTSEKDV | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 325 | AKRLQPDVTSEKDV | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of KDM5C-HSD17B10 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 7 | 16 | KRLQPDVTS | AAGAGACTGCAGCCTGATGTGACCTCT |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 7 | 18 | KRLQPDVTSEK | AAGAGACTGCAGCCTGATGTGACCTCTGAGAAG |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 8 | 18 | RLQPDVTSEK | AGACTGCAGCCTGATGTGACCTCTGAGAAG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 5 | 20 | RAKRLQPDVTSEKDV | CGGGCCAAGAGACTGCAGCCTGATGTGACCTCTGAGAAGGATGTG |
| KDM5C-HSD17B10 | chrX | 53246325 | chrX | 53459359 | 6 | 21 | AKRLQPDVTSEKDVQ | GCCAAGAGACTGCAGCCTGATGTGACCTCTGAGAAGGATGTGCAA |
Top |
Information of the samples that have these potential fusion neoantigens of KDM5C-HSD17B10 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BRCA | KDM5C-HSD17B10 | chrX | 53246325 | ENST00000375379 | chrX | 53459359 | ENST00000168216 | TCGA-GM-A2DF-01A |
Top |
Potential target of CAR-T therapy development for KDM5C-HSD17B10 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to KDM5C-HSD17B10 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to KDM5C-HSD17B10 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies