Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KIF5C-EPC2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KIF5C-EPC2
	FusionPDB ID: 42737
	FusionGDB2.0 ID: 42737
		Hgene	Tgene
	Gene symbol	KIF5C	EPC2
	Gene ID	3800	26122
	Gene name	kinesin family member 5C	enhancer of polycomb homolog 2
	Synonyms	CDCBM2\|KINN\|NKHC\|NKHC-2\|NKHC2	EPC-LIKE
	Cytomap	2q23.1-q23.2	2q23.1
	Type of gene	protein-coding	protein-coding
	Description	kinesin heavy chain isoform 5Ckinesin heavy chainkinesin heavy chain neuron-specific 2	enhancer of polycomb homolog 2
	Modification date	20200313	20200313
	UniProtAcc	O60282 Main function of 5'-partner protein: FUNCTION: Involved in synaptic transmission (PubMed:24812067). Mediates dendritic trafficking of mRNAs (By similarity). Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity). {ECO:0000250\|UniProtKB:P28738, ECO:0000250\|UniProtKB:P56536, ECO:0000269\|PubMed:24812067}.	Q52LR7 Main function of 5'-partner protein: FUNCTION: May play a role in transcription or DNA repair. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000464066, ENST00000397413, ENST00000414838, ENST00000435030,	ENST00000258484, ENST00000409654,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 7 X 5=280	13 X 8 X 4=416
	# samples	8	14
	** MAII score	log2(8/280*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/416*10)=-1.57115670119613 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KIF5C [Title/Abstract] AND EPC2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KIF5C [Title/Abstract] AND EPC2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KIF5C(149840280)-EPC2(149447783), # samples:1
Anticipated loss of major functional domain due to fusion event.	KIF5C-EPC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KIF5C-EPC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KIF5C-EPC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KIF5C-EPC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:149840280/chr2:149447783)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KIF5C (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EPC2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000435030	KIF5C	chr2	149840280	+	ENST00000258484	EPC2	chr2	149447783	+	5539	2084	368	4354	1328
ENST00000435030	KIF5C	chr2	149840280	+	ENST00000409654	EPC2	chr2	149447783	+	3536	2084	368	2296	642
ENST00000414838	KIF5C	chr2	149840280	+	ENST00000258484	EPC2	chr2	149447783	+	4886	1431	0	3701	1233
ENST00000414838	KIF5C	chr2	149840280	+	ENST00000409654	EPC2	chr2	149447783	+	2883	1431	0	1643	547
ENST00000397413	KIF5C	chr2	149840280	+	ENST00000258484	EPC2	chr2	149447783	+	4475	1020	0	3290	1096
ENST00000397413	KIF5C	chr2	149840280	+	ENST00000409654	EPC2	chr2	149447783	+	2472	1020	0	1232	410

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000435030	ENST00000258484	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000666048	0.9993339
ENST00000435030	ENST00000409654	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000482386	0.99951756
ENST00000414838	ENST00000258484	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000416245	0.9995838
ENST00000414838	ENST00000409654	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000292025	0.999708
ENST00000397413	ENST00000258484	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000462262	0.9995377
ENST00000397413	ENST00000409654	KIF5C	chr2	149840280	+	EPC2	chr2	149447783	+	0.000662246	0.99933773

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KIF5C-EPC2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KIF5C	chr2	149840280	EPC2	chr2	149447783	1020	340	EIGGIIGTNDVKTEHHLQRAISAQQV
KIF5C	chr2	149840280	EPC2	chr2	149447783	1431	477	EIGGIIGTNDVKTEHHLQRAISAQQV
KIF5C	chr2	149840280	EPC2	chr2	149447783	2084	572	EIGGIIGTNDVKTEHHLQRAISAQQV

Top

Potential FusionNeoAntigen Information of KIF5C-EPC2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KIF5C-EPC2_149840280_149447783.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:02	TEHHLQRA	0.9998	0.769	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B41:01	TEHHLQRA	0.9923	0.9001	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:01	TEHHLQRA	0.9782	0.8435	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:02	TEHHLQRAI	0.9941	0.7138	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B45:01	TEHHLQRAI	0.9874	0.9217	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B44:03	TEHHLQRAI	0.9868	0.9691	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B18:01	TEHHLQRAI	0.872	0.9187	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B41:01	TEHHLQRAI	0.7477	0.9104	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B39:13	TEHHLQRAI	0.5939	0.9745	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:01	TEHHLQRAI	0.4014	0.7619	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B52:01	TEHHLQRAI	0.3214	0.9439	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-A66:01	DVKTEHHLQR	0.9585	0.5049	9	19
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B45:01	TEHHLQRAISA	0.9994	0.9823	12	23
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:02	TEHHLQRAISA	0.9978	0.7582	12	23
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B39:06	TEHHLQRAISA	0.9862	0.909	12	23
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B40:06	TEHHLQRA	0.9999	0.8534	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B40:06	TEHHLQRAI	0.9994	0.6752	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B44:10	TEHHLQRAI	0.9956	0.5227	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B51:07	TEHHLQRAI	0.211	0.7935	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B40:06	TEHHLQRAISA	0.9997	0.8399	12	23
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:04	TEHHLQRA	0.9782	0.8435	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:05	TEHHLQRA	0.9782	0.8435	12	20
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B08:12	DVKTEHHL	0.8907	0.5337	9	17
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B40:04	TEHHLQRAI	0.9973	0.6993	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B44:13	TEHHLQRAI	0.9868	0.9691	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B44:07	TEHHLQRAI	0.9868	0.9691	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B44:26	TEHHLQRAI	0.9868	0.9691	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B41:03	TEHHLQRAI	0.8888	0.6924	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B18:05	TEHHLQRAI	0.872	0.9187	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B18:03	TEHHLQRAI	0.8577	0.9153	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B18:06	TEHHLQRAI	0.8324	0.9338	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B18:11	TEHHLQRAI	0.683	0.9405	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B39:02	TEHHLQRAI	0.6053	0.9738	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:04	TEHHLQRAI	0.4014	0.7619	12	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	HLA-B50:05	TEHHLQRAI	0.4014	0.7619	12	21

Top

Potential FusionNeoAntigen Information of KIF5C-EPC2 in HLA II

KIF5C-EPC2_149840280_149447783.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	DRB1-0303	TNDVKTEHHLQRAIS	7	22
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	DRB1-0303	GTNDVKTEHHLQRAI	6	21
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	DRB1-0307	TNDVKTEHHLQRAIS	7	22
KIF5C-EPC2	chr2	149840280	chr2	149447783	1020	DRB1-1107	TNDVKTEHHLQRAIS	7	22

Top

Fusion breakpoint peptide structures of KIF5C-EPC2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3177	GTNDVKTEHHLQRA	KIF5C	EPC2	chr2	149840280	chr2	149447783	1020

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KIF5C-EPC2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3177	GTNDVKTEHHLQRA	-7.15543	-7.26883
HLA-B14:02	3BVN	3177	GTNDVKTEHHLQRA	-4.77435	-5.80965
HLA-B52:01	3W39	3177	GTNDVKTEHHLQRA	-6.80875	-6.92215
HLA-B52:01	3W39	3177	GTNDVKTEHHLQRA	-4.20386	-5.23916
HLA-A11:01	4UQ2	3177	GTNDVKTEHHLQRA	-7.5194	-8.5547
HLA-A11:01	4UQ2	3177	GTNDVKTEHHLQRA	-6.9601	-7.0735
HLA-A24:02	5HGA	3177	GTNDVKTEHHLQRA	-7.52403	-7.63743
HLA-A24:02	5HGA	3177	GTNDVKTEHHLQRA	-5.82433	-6.85963
HLA-B27:05	6PYJ	3177	GTNDVKTEHHLQRA	-3.28285	-4.31815
HLA-B44:05	3DX8	3177	GTNDVKTEHHLQRA	-5.91172	-6.94702
HLA-B44:05	3DX8	3177	GTNDVKTEHHLQRA	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of KIF5C-EPC2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KIF5C-EPC2	chr2	149840280	chr2	149447783	12	20	TEHHLQRA	ACTGAACATCATTTACAGCGAGCA
KIF5C-EPC2	chr2	149840280	chr2	149447783	12	21	TEHHLQRAI	ACTGAACATCATTTACAGCGAGCAATT
KIF5C-EPC2	chr2	149840280	chr2	149447783	12	23	TEHHLQRAISA	ACTGAACATCATTTACAGCGAGCAATTTCAGCA
KIF5C-EPC2	chr2	149840280	chr2	149447783	9	17	DVKTEHHL	GATGTGAAAACTGAACATCATTTA
KIF5C-EPC2	chr2	149840280	chr2	149447783	9	19	DVKTEHHLQR	GATGTGAAAACTGAACATCATTTACAGCGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KIF5C-EPC2	chr2	149840280	chr2	149447783	6	21	GTNDVKTEHHLQRAI	GGCACCAATGATGTGAAAACTGAACATCATTTACAGCGAGCAATT
KIF5C-EPC2	chr2	149840280	chr2	149447783	7	22	TNDVKTEHHLQRAIS	ACCAATGATGTGAAAACTGAACATCATTTACAGCGAGCAATTTCA

Top

Information of the samples that have these potential fusion neoantigens of KIF5C-EPC2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	KIF5C-EPC2	chr2	149840280	ENST00000397413	chr2	149447783	ENST00000258484	TCGA-BT-A20W-01A

Top

Potential target of CAR-T therapy development for KIF5C-EPC2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KIF5C-EPC2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KIF5C-EPC2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)