Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KLK8-NLRP4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KLK8-NLRP4
	FusionPDB ID: 43107
	FusionGDB2.0 ID: 43107
		Hgene	Tgene
	Gene symbol	KLK8	NLRP4
	Gene ID	11202	147945
	Gene name	kallikrein related peptidase 8	NLR family pyrin domain containing 4
	Synonyms	HNP\|NP\|NRPN\|PRSS19\|TADG14	CLR19.5\|CT58\|NALP4\|PAN2\|PYPAF4\|RNH2
	Cytomap	19q13.41	19q13.43
	Type of gene	protein-coding	protein-coding
	Description	kallikrein-8ovasinserine protease 19serine protease TADG-14tumor-associated differentially expressed gene 14 protein	NACHT, LRR and PYD domains-containing protein 4NACHT, leucine rich repeat and PYD containing 4PAAD and NACHT-containing protein 2PYRIN and NACHT-containing protein 2PYRIN-containing APAF1-like protein 4cancer/testis antigen 58nucleotide-binding olig
	Modification date	20200313	20200313
	UniProtAcc	O60259 Main function of 5'-partner protein: FUNCTION: Serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Also cleaves L1CAM in response to increased neural activity. Induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway, regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. Involved in skin desquamation and keratinocyte proliferation. Plays a role in the secondary phase of pathogenesis following spinal cord injury. {ECO:0000269\|PubMed:16337200}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000598195, ENST00000291726, ENST00000347619, ENST00000391806, ENST00000593490, ENST00000600767, ENST00000320838,	ENST00000301295, ENST00000346986, ENST00000587891,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	1 X 3 X 1=3	5 X 7 X 4=140
	# samples	2	7
	** MAII score	log2(2/3*10)=2.73696559416621	log2(7/140*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KLK8 [Title/Abstract] AND NLRP4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KLK8 [Title/Abstract] AND NLRP4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KLK8(51504353)-NLRP4(56388361), # samples:1 KLK8(51504354)-NLRP4(56388362), # samples:1 KLK8(51501007)-NLRP4(56388362), # samples:1
Anticipated loss of major functional domain due to fusion event.	KLK8-NLRP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KLK8-NLRP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KLK8-NLRP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KLK8-NLRP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KLK8-NLRP4 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. KLK8-NLRP4 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:51504353/chr19:56388361)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KLK8 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NLRP4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000391806	KLK8	chr19	51504353	-	ENST00000301295	NLRP4	chr19	56388361	+	874	151	59	610	183
ENST00000391806	KLK8	chr19	51504353	-	ENST00000346986	NLRP4	chr19	56388361	+	876	151	59	610	183
ENST00000391806	KLK8	chr19	51504353	-	ENST00000587891	NLRP4	chr19	56388361	+	878	151	59	610	183
ENST00000291726	KLK8	chr19	51504353	-	ENST00000301295	NLRP4	chr19	56388361	+	972	249	157	708	183
ENST00000291726	KLK8	chr19	51504353	-	ENST00000346986	NLRP4	chr19	56388361	+	974	249	157	708	183
ENST00000291726	KLK8	chr19	51504353	-	ENST00000587891	NLRP4	chr19	56388361	+	976	249	157	708	183
ENST00000320838	KLK8	chr19	51504353	-	ENST00000301295	NLRP4	chr19	56388361	+	972	249	157	708	183
ENST00000320838	KLK8	chr19	51504353	-	ENST00000346986	NLRP4	chr19	56388361	+	974	249	157	708	183
ENST00000320838	KLK8	chr19	51504353	-	ENST00000587891	NLRP4	chr19	56388361	+	976	249	157	708	183
ENST00000347619	KLK8	chr19	51504353	-	ENST00000301295	NLRP4	chr19	56388361	+	938	215	123	674	183
ENST00000347619	KLK8	chr19	51504353	-	ENST00000346986	NLRP4	chr19	56388361	+	940	215	123	674	183
ENST00000347619	KLK8	chr19	51504353	-	ENST00000587891	NLRP4	chr19	56388361	+	942	215	123	674	183
ENST00000391806	KLK8	chr19	51504354	-	ENST00000301295	NLRP4	chr19	56388362	+	874	151	59	610	183
ENST00000391806	KLK8	chr19	51504354	-	ENST00000346986	NLRP4	chr19	56388362	+	876	151	59	610	183
ENST00000391806	KLK8	chr19	51504354	-	ENST00000587891	NLRP4	chr19	56388362	+	878	151	59	610	183
ENST00000291726	KLK8	chr19	51504354	-	ENST00000301295	NLRP4	chr19	56388362	+	972	249	157	708	183
ENST00000291726	KLK8	chr19	51504354	-	ENST00000346986	NLRP4	chr19	56388362	+	974	249	157	708	183
ENST00000291726	KLK8	chr19	51504354	-	ENST00000587891	NLRP4	chr19	56388362	+	976	249	157	708	183
ENST00000320838	KLK8	chr19	51504354	-	ENST00000301295	NLRP4	chr19	56388362	+	972	249	157	708	183
ENST00000320838	KLK8	chr19	51504354	-	ENST00000346986	NLRP4	chr19	56388362	+	974	249	157	708	183
ENST00000320838	KLK8	chr19	51504354	-	ENST00000587891	NLRP4	chr19	56388362	+	976	249	157	708	183
ENST00000347619	KLK8	chr19	51504354	-	ENST00000301295	NLRP4	chr19	56388362	+	938	215	123	674	183
ENST00000347619	KLK8	chr19	51504354	-	ENST00000346986	NLRP4	chr19	56388362	+	940	215	123	674	183
ENST00000347619	KLK8	chr19	51504354	-	ENST00000587891	NLRP4	chr19	56388362	+	942	215	123	674	183
ENST00000600767	KLK8	chr19	51501007	-	ENST00000301295	NLRP4	chr19	56388362	+	1840	1117	475	1152	225
ENST00000600767	KLK8	chr19	51501007	-	ENST00000346986	NLRP4	chr19	56388362	+	1842	1117	475	1152	225
ENST00000600767	KLK8	chr19	51501007	-	ENST00000587891	NLRP4	chr19	56388362	+	1844	1117	475	1152	225

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000391806	ENST00000301295	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.90343773	0.09656231
ENST00000391806	ENST00000346986	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9036328	0.09636718
ENST00000391806	ENST00000587891	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9005786	0.09942135
ENST00000291726	ENST00000301295	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.93309075	0.066909224
ENST00000291726	ENST00000346986	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9342664	0.06573357
ENST00000291726	ENST00000587891	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9336454	0.06635459
ENST00000320838	ENST00000301295	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.93309075	0.066909224
ENST00000320838	ENST00000346986	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9342664	0.06573357
ENST00000320838	ENST00000587891	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9336454	0.06635459
ENST00000347619	ENST00000301295	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9578945	0.042105448
ENST00000347619	ENST00000346986	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9587488	0.04125118
ENST00000347619	ENST00000587891	KLK8	chr19	51504353	-	NLRP4	chr19	56388361	+	0.9578933	0.042106688
ENST00000391806	ENST00000301295	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.90343773	0.09656231
ENST00000391806	ENST00000346986	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9036328	0.09636718
ENST00000391806	ENST00000587891	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9005786	0.09942135
ENST00000291726	ENST00000301295	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.93309075	0.066909224
ENST00000291726	ENST00000346986	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9342664	0.06573357
ENST00000291726	ENST00000587891	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9336454	0.06635459
ENST00000320838	ENST00000301295	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.93309075	0.066909224
ENST00000320838	ENST00000346986	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9342664	0.06573357
ENST00000320838	ENST00000587891	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9336454	0.06635459
ENST00000347619	ENST00000301295	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9578945	0.042105448
ENST00000347619	ENST00000346986	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9587488	0.04125118
ENST00000347619	ENST00000587891	KLK8	chr19	51504354	-	NLRP4	chr19	56388362	+	0.9578933	0.042106688
ENST00000600767	ENST00000301295	KLK8	chr19	51501007	-	NLRP4	chr19	56388362	+	0.09738155	0.9026184
ENST00000600767	ENST00000346986	KLK8	chr19	51501007	-	NLRP4	chr19	56388362	+	0.09614783	0.9038522
ENST00000600767	ENST00000587891	KLK8	chr19	51501007	-	NLRP4	chr19	56388362	+	0.095603466	0.90439653

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KLK8-NLRP4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KLK8	chr19	51504353	NLRP4	chr19	56388361	151	28	GQDVDVPALAGGSLGSLVKCFITAAG
KLK8	chr19	51504353	NLRP4	chr19	56388361	215	28	GQDVDVPALAGGSLGSLVKCFITAAG
KLK8	chr19	51504353	NLRP4	chr19	56388361	249	28	GQDVDVPALAGGSLGSLVKCFITAAG
KLK8	chr19	51504354	NLRP4	chr19	56388362	151	28	GQDVDVPALAGGSLGSLVKCFITAAG
KLK8	chr19	51504354	NLRP4	chr19	56388362	215	28	GQDVDVPALAGGSLGSLVKCFITAAG
KLK8	chr19	51504354	NLRP4	chr19	56388362	249	28	GQDVDVPALAGGSLGSLVKCFITAAG

Top

Potential FusionNeoAntigen Information of KLK8-NLRP4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KLK8-NLRP4_51504353_56388361.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:03	VPALAGGSL	0.9408	0.7515	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:01	VPALAGGSL	0.9386	0.7336	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:08	VPALAGGSL	0.9349	0.7016	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:02	VPALAGGSL	0.7608	0.9324	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:04	VPALAGGSL	0.7608	0.9324	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B82:01	VPALAGGSL	0.1194	0.7059	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B57:03	GSLGSLVKCF	0.9949	0.9791	11	21
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:22	ALAGGSLGSL	0.9877	0.5546	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:13	ALAGGSLGSL	0.9793	0.7295	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:27	ALAGGSLGSL	0.9618	0.6408	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:38	ALAGGSLGSL	0.955	0.7014	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:13	ALAGGSLGSLV	0.9981	0.7723	7	18
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:27	ALAGGSLGSLV	0.9971	0.7069	7	18
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:38	ALAGGSLGSLV	0.9958	0.7581	7	18
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:16	ALAGGSLGSLV	0.9904	0.5721	7	18
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B81:01	VDVPALAGGSL	0.9875	0.7549	3	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B07:02	VDVPALAGGSL	0.983	0.5179	3	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B07:12	VPALAGGSL	0.9842	0.5075	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:12	VPALAGGSL	0.7608	0.9324	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B39:10	VPALAGGSL	0.6027	0.8852	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B42:02	VPALAGGSL	0.5745	0.7284	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B78:01	VPALAGGSL	0.5389	0.532	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B42:01	VPALAGGSL	0.5115	0.719	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B07:12	VDVPALAGGSL	0.9961	0.5795	3	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:77	VPALAGGSL	0.9386	0.7336	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:23	VPALAGGSL	0.9363	0.7597	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:13	VPALAGGSL	0.924	0.7589	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:17	VPALAGGSL	0.807	0.6328	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:30	VPALAGGSL	0.807	0.6328	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:11	VPALAGGSL	0.7954	0.7925	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:09	VPALAGGSL	0.7608	0.9324	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B67:01	VPALAGGSL	0.6125	0.7922	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B78:02	VPALAGGSL	0.5275	0.5203	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B82:02	VPALAGGSL	0.1194	0.7059	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B35:43	VPALAGGSL	0.0129	0.6954	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B15:08	VPALAGGSL	0.0121	0.7025	5	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:03	ALAGGSLGSL	0.9903	0.6656	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B15:73	ALAGGSLGSL	0.9887	0.9874	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B15:30	ALAGGSLGSL	0.9762	0.978	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B40:21	ALAGGSLGSL	0.2519	0.9061	7	17
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-A02:03	ALAGGSLGSLV	0.9993	0.7346	7	18
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B07:22	VDVPALAGGSL	0.983	0.5179	3	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B55:04	VDVPALAGGSL	0.982	0.5451	3	14
KLK8-NLRP4	chr19	51504353	chr19	56388361	249	HLA-B67:01	VDVPALAGGSL	0.9802	0.8975	3	14

Top

Potential FusionNeoAntigen Information of KLK8-NLRP4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of KLK8-NLRP4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6489	PALAGGSLGSLVKC	KLK8	NLRP4	chr19	51504353	chr19	56388361	249

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KLK8-NLRP4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6489	PALAGGSLGSLVKC	-7.9962	-8.1096
HLA-B14:02	3BVN	6489	PALAGGSLGSLVKC	-5.70842	-6.74372
HLA-B52:01	3W39	6489	PALAGGSLGSLVKC	-6.83737	-6.95077
HLA-B52:01	3W39	6489	PALAGGSLGSLVKC	-4.4836	-5.5189
HLA-A11:01	4UQ2	6489	PALAGGSLGSLVKC	-10.0067	-10.1201
HLA-A11:01	4UQ2	6489	PALAGGSLGSLVKC	-9.03915	-10.0745
HLA-A24:02	5HGA	6489	PALAGGSLGSLVKC	-6.56204	-6.67544
HLA-A24:02	5HGA	6489	PALAGGSLGSLVKC	-5.42271	-6.45801
HLA-B44:05	3DX8	6489	PALAGGSLGSLVKC	-7.85648	-8.89178
HLA-B44:05	3DX8	6489	PALAGGSLGSLVKC	-5.3978	-5.5112
HLA-A02:01	6TDR	6489	PALAGGSLGSLVKC	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KLK8-NLRP4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KLK8-NLRP4	chr19	51504353	chr19	56388361	11	21	GSLGSLVKCF	GGGCAGTTTGGTAAAATGTTTTATCACTGC
KLK8-NLRP4	chr19	51504353	chr19	56388361	3	14	VDVPALAGGSL	TCCTGCTCTTGCTGGGGGGAGCCTGGGCAGTTT
KLK8-NLRP4	chr19	51504353	chr19	56388361	5	14	VPALAGGSL	TCTTGCTGGGGGGAGCCTGGGCAGTTT
KLK8-NLRP4	chr19	51504353	chr19	56388361	7	17	ALAGGSLGSL	TGGGGGGAGCCTGGGCAGTTTGGTAAAATG
KLK8-NLRP4	chr19	51504353	chr19	56388361	7	18	ALAGGSLGSLV	TGGGGGGAGCCTGGGCAGTTTGGTAAAATGTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of KLK8-NLRP4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	KLK8-NLRP4	chr19	51504353	ENST00000291726	chr19	56388361	ENST00000301295	TCGA-23-1024

Top

Potential target of CAR-T therapy development for KLK8-NLRP4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KLK8-NLRP4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KLK8-NLRP4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)