Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LDLR-ACY1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LDLR-ACY1
	FusionPDB ID: 44351
	FusionGDB2.0 ID: 44351
		Hgene	Tgene
	Gene symbol	LDLR	ACY1
	Gene ID	3949	95
	Gene name	low density lipoprotein receptor	aminoacylase 1
	Synonyms	FH\|FHC\|FHCL1\|LDLCQ2	ACY-1\|ACY1D\|HEL-S-5
	Cytomap	19p13.2	3p21.2
	Type of gene	protein-coding	protein-coding
	Description	low-density lipoprotein receptorLDL receptorlow-density lipoprotein receptor class A domain-containing protein 3	aminoacylase-1N-acyl-L-amino-acid amidohydrolaseacylaseepididymis secretory protein Li 5
	Modification date	20200322	20200313
	UniProtAcc	Q5SW96 Main function of 5'-partner protein: FUNCTION: Adapter protein (clathrin-associated sorting protein (CLASP)) required for efficient endocytosis of the LDL receptor (LDLR) in polarized cells such as hepatocytes and lymphocytes, but not in non-polarized cells (fibroblasts). May be required for LDL binding and internalization but not for receptor clustering in coated pits. May facilitate the endocytocis of LDLR and LDLR-LDL complexes from coated pits by stabilizing the interaction between the receptor and the structural components of the pits. May also be involved in the internalization of other LDLR family members. Binds to phosphoinositides, which regulate clathrin bud assembly at the cell surface. Required for trafficking of LRP2 to the endocytic recycling compartment which is necessary for LRP2 proteolysis, releasing a tail fragment which translocates to the nucleus and mediates transcriptional repression (By similarity). {ECO:0000250\|UniProtKB:D3ZAR1, ECO:0000269\|PubMed:15728179}.	Q03154 Main function of 5'-partner protein: FUNCTION: Involved in the hydrolysis of N-acylated or N-acetylated amino acids (except L-aspartate). {ECO:0000269\|PubMed:12933810}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000455727, ENST00000535915, ENST00000545707, ENST00000557933, ENST00000558013, ENST00000558518, ENST00000560628,	ENST00000468068, ENST00000404366, ENST00000476351, ENST00000458031, ENST00000476854, ENST00000494103,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 17 X 15=5865	3 X 6 X 3=54
	# samples	33	4
	** MAII score	log2(33/5865*10)=-4.15159317867005 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/54*10)=-0.432959407276106 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LDLR [Title/Abstract] AND ACY1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LDLR [Title/Abstract] AND ACY1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LDLR(11222315)-ACY1(52019222), # samples:1 LDLR(11222315)-ACY1(52019223), # samples:1
Anticipated loss of major functional domain due to fusion event.	LDLR-ACY1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LDLR-ACY1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LDLR-ACY1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LDLR-ACY1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:11222315/chr3:52019222)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LDLR (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ACY1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000558518	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2614	1373	169	2505	778
ENST00000558518	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	2412	1373	169	2289	706
ENST00000558518	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	2433	1373	169	2310	713
ENST00000557933	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2514	1273	69	2405	778
ENST00000557933	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	2312	1273	69	2189	706
ENST00000557933	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	2333	1273	69	2210	713
ENST00000455727	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2009	768	68	1900	610
ENST00000455727	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	1807	768	68	1684	538
ENST00000455727	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	1828	768	68	1705	545
ENST00000535915	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2390	1149	68	2281	737
ENST00000535915	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	2188	1149	68	2065	665
ENST00000535915	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	2209	1149	68	2086	672
ENST00000545707	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2132	891	68	2023	651
ENST00000545707	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	1930	891	68	1807	579
ENST00000545707	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	1951	891	68	1828	586
ENST00000558013	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019222	+	2498	1257	53	2389	778
ENST00000558013	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019222	+	2296	1257	53	2173	706
ENST00000558013	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019222	+	2317	1257	53	2194	713
ENST00000558518	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2614	1373	169	2505	778
ENST00000558518	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	2412	1373	169	2289	706
ENST00000558518	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	2433	1373	169	2310	713
ENST00000557933	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2514	1273	69	2405	778
ENST00000557933	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	2312	1273	69	2189	706
ENST00000557933	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	2333	1273	69	2210	713
ENST00000455727	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2009	768	68	1900	610
ENST00000455727	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	1807	768	68	1684	538
ENST00000455727	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	1828	768	68	1705	545
ENST00000535915	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2390	1149	68	2281	737
ENST00000535915	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	2188	1149	68	2065	665
ENST00000535915	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	2209	1149	68	2086	672
ENST00000545707	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2132	891	68	2023	651
ENST00000545707	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	1930	891	68	1807	579
ENST00000545707	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	1951	891	68	1828	586
ENST00000558013	LDLR	chr19	11222315	+	ENST00000458031	ACY1	chr3	52019223	+	2498	1257	53	2389	778
ENST00000558013	LDLR	chr19	11222315	+	ENST00000494103	ACY1	chr3	52019223	+	2296	1257	53	2173	706
ENST00000558013	LDLR	chr19	11222315	+	ENST00000476854	ACY1	chr3	52019223	+	2317	1257	53	2194	713

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000558518	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.011846315	0.98815376
ENST00000558518	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.014507916	0.98549205
ENST00000558518	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.016812818	0.9831872
ENST00000557933	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.011880087	0.98811984
ENST00000557933	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.014801628	0.9851983
ENST00000557933	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.016738493	0.9832615
ENST00000455727	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.016419258	0.98358077
ENST00000455727	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.022035573	0.9779644
ENST00000455727	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.024077492	0.97592247
ENST00000535915	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.01108578	0.9889142
ENST00000535915	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.01602114	0.98397887
ENST00000535915	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.016221406	0.98377854
ENST00000545707	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.01848895	0.98151106
ENST00000545707	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.020890849	0.97910917
ENST00000545707	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.022063768	0.97793627
ENST00000558013	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.011970175	0.9880298
ENST00000558013	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.014926088	0.9850739
ENST00000558013	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019222	+	0.01697899	0.983021
ENST00000558518	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.011846315	0.98815376
ENST00000558518	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.014507916	0.98549205
ENST00000558518	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.016812818	0.9831872
ENST00000557933	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.011880087	0.98811984
ENST00000557933	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.014801628	0.9851983
ENST00000557933	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.016738493	0.9832615
ENST00000455727	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.016419258	0.98358077
ENST00000455727	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.022035573	0.9779644
ENST00000455727	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.024077492	0.97592247
ENST00000535915	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.01108578	0.9889142
ENST00000535915	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.01602114	0.98397887
ENST00000535915	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.016221406	0.98377854
ENST00000545707	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.01848895	0.98151106
ENST00000545707	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.020890849	0.97910917
ENST00000545707	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.022063768	0.97793627
ENST00000558013	ENST00000458031	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.011970175	0.9880298
ENST00000558013	ENST00000494103	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.014926088	0.9850739
ENST00000558013	ENST00000476854	LDLR	chr19	11222315	+	ACY1	chr3	52019223	+	0.01697899	0.983021

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LDLR-ACY1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LDLR	chr19	11222315	ACY1	chr3	52019222	1149	360	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019222	1257	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019222	1273	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019222	1373	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019222	768	233	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019222	891	274	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	1149	360	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	1257	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	1273	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	1373	401	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	768	233	FQLDPHTKACKAVGAAVAFFEETARQ
LDLR	chr19	11222315	ACY1	chr3	52019223	891	274	FQLDPHTKACKAVGAAVAFFEETARQ

Top

Potential FusionNeoAntigen Information of LDLR-ACY1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LDLR-ACY1_11222315_52019222.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:25	KAVGAAVAF	0.998	0.9244	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:17	KAVGAAVAF	0.9969	0.9245	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:16	KAVGAAVAF	0.9962	0.862	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:03	KAVGAAVAF	0.9946	0.8485	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:01	KAVGAAVAF	0.9942	0.8836	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B58:02	KAVGAAVAF	0.9937	0.9749	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B57:03	KAVGAAVAF	0.9902	0.9873	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B58:01	KAVGAAVAF	0.9898	0.9647	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:08	KAVGAAVAF	0.9814	0.8939	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:01	KAVGAAVAF	0.9647	0.885	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B46:01	KAVGAAVAF	0.9507	0.5846	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:05	KAVGAAVAF	0.947	0.7185	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B57:03	KAVGAAVAFF	0.9987	0.991	10	20
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:21	KAVGAAVAF	0.9962	0.9216	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:07	KAVGAAVAF	0.9953	0.7442	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C15:04	KAVGAAVAF	0.9891	0.9296	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:19	KAVGAAVAF	0.9882	0.9898	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:08	KAVGAAVAF	0.9877	0.8402	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:07	KAVGAAVAF	0.9728	0.9687	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:05	KAVGAAVAF	0.9721	0.8633	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:14	KAVGAAVAF	0.923	0.9768	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C12:12	KAVGAAVAF	0.8569	0.9313	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C06:03	KAVGAAVAF	0.6917	0.9928	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C12:04	KAVGAAVAF	0.6816	0.9945	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C02:06	KAVGAAVAF	0.6734	0.9832	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C08:04	KAVGAAVAF	0.5816	0.9926	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C08:13	KAVGAAVAF	0.5816	0.9926	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:39	KAVGAAVAF	0.998	0.8765	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:11	KAVGAAVAF	0.9965	0.9034	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B58:06	KAVGAAVAF	0.9962	0.9636	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:02	KAVGAAVAF	0.9949	0.9779	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:125	KAVGAAVAF	0.9942	0.8836	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:34	KAVGAAVAF	0.9942	0.8836	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:33	KAVGAAVAF	0.9942	0.8836	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:27	KAVGAAVAF	0.994	0.9081	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:11	KAVGAAVAF	0.9935	0.8743	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:08	KAVGAAVAF	0.9932	0.8695	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:43	KAVGAAVAF	0.992	0.8701	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:24	KAVGAAVAF	0.9893	0.9497	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C15:09	KAVGAAVAF	0.9891	0.9296	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-A32:01	KAVGAAVAF	0.9841	0.9486	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:04	KAVGAAVAF	0.9836	0.9839	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:03	KAVGAAVAF	0.9836	0.9839	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:05	KAVGAAVAF	0.9804	0.8995	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:17	KAVGAAVAF	0.9786	0.9606	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:17	KAVGAAVAF	0.9779	0.8173	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:30	KAVGAAVAF	0.9779	0.8173	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:20	KAVGAAVAF	0.973	0.9038	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:28	KAVGAAVAF	0.9692	0.907	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:77	KAVGAAVAF	0.9647	0.885	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:20	KAVGAAVAF	0.9645	0.913	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C16:04	KAVGAAVAF	0.9624	0.9786	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:23	KAVGAAVAF	0.9597	0.8932	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B57:02	KAVGAAVAF	0.9549	0.9179	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B48:02	KAVGAAVAF	0.9454	0.8898	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C16:01	KAVGAAVAF	0.9116	0.9818	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:13	KAVGAAVAF	0.8409	0.9127	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B15:30	KAVGAAVAF	0.8225	0.9539	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C12:03	KAVGAAVAF	0.8171	0.987	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C12:02	KAVGAAVAF	0.8155	0.9784	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C16:02	KAVGAAVAF	0.7796	0.9932	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C02:10	KAVGAAVAF	0.71	0.9809	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C02:02	KAVGAAVAF	0.71	0.9809	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-C03:06	KAVGAAVAF	0.6989	0.9901	10	19
LDLR-ACY1	chr19	11222315	chr3	52019222	768	HLA-B35:24	KAVGAAVAF	0.6771	0.8859	10	19

Top

Potential FusionNeoAntigen Information of LDLR-ACY1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of LDLR-ACY1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9422	TKACKAVGAAVAFF	LDLR	ACY1	chr19	11222315	chr3	52019222	768

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LDLR-ACY1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9422	TKACKAVGAAVAFF	-7.15543	-7.26883
HLA-B14:02	3BVN	9422	TKACKAVGAAVAFF	-4.77435	-5.80965
HLA-B52:01	3W39	9422	TKACKAVGAAVAFF	-6.80875	-6.92215
HLA-B52:01	3W39	9422	TKACKAVGAAVAFF	-4.20386	-5.23916
HLA-A11:01	4UQ2	9422	TKACKAVGAAVAFF	-7.5194	-8.5547
HLA-A11:01	4UQ2	9422	TKACKAVGAAVAFF	-6.9601	-7.0735
HLA-A24:02	5HGA	9422	TKACKAVGAAVAFF	-7.52403	-7.63743
HLA-A24:02	5HGA	9422	TKACKAVGAAVAFF	-5.82433	-6.85963
HLA-B27:05	6PYJ	9422	TKACKAVGAAVAFF	-3.28285	-4.31815
HLA-B44:05	3DX8	9422	TKACKAVGAAVAFF	-5.91172	-6.94702
HLA-B44:05	3DX8	9422	TKACKAVGAAVAFF	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of LDLR-ACY1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LDLR-ACY1	chr19	11222315	chr3	52019222	10	19	KAVGAAVAF	AGGCTGTGGGAGCTGCTGTGGCTTTCT
LDLR-ACY1	chr19	11222315	chr3	52019222	10	20	KAVGAAVAFF	AGGCTGTGGGAGCTGCTGTGGCTTTCTTTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of LDLR-ACY1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	LDLR-ACY1	chr19	11222315	ENST00000455727	chr3	52019222	ENST00000458031	TCGA-CG-5730-11A

Top

Potential target of CAR-T therapy development for LDLR-ACY1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LDLR-ACY1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LDLR-ACY1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)