Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LETM2-ERCC2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LETM2-ERCC2
	FusionPDB ID: 44492
	FusionGDB2.0 ID: 44492
		Hgene	Tgene
	Gene symbol	LETM2	ERCC2
	Gene ID	137994	2068
	Gene name	leucine zipper and EF-hand containing transmembrane protein 2	ERCC excision repair 2, TFIIH core complex helicase subunit
	Synonyms	SLC55A2	COFS2\|EM9\|TFIIH\|TTD\|TTD1\|XPD
	Cytomap	8p11.23	19q13.32
	Type of gene	protein-coding	protein-coding
	Description	LETM1 domain-containing protein LETM2, mitochondrialLETM1 and EF-hand domain-containing protein 2leucine zipper-EF-hand containing transmembrane protein 1-like proteinleucine zipper-EF-hand containing transmembrane protein 2	general transcription and DNA repair factor IIH helicase subunit XPDBTF2 p80CXPDDNA excision repair protein ERCC-2DNA repair protein complementing XP-D cellsTFIIH 80 kDa subunitTFIIH basal transcription factor complex 80 kDa subunitTFIIH basal tran
	Modification date	20200313	20200315
	UniProtAcc	Q2VYF4 Main function of 5'-partner protein:	P18074 Main function of 5'-partner protein: FUNCTION: ATP-dependent 5'-3' DNA helicase, component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II. In NER, TFIIH acts by opening DNA around the lesion to allow the excision of the damaged oligonucleotide and its replacement by a new DNA fragment. The ATP-dependent helicase activity of XPD/ERCC2 is required for DNA opening. In transcription, TFIIH has an essential role in transcription initiation. When the pre-initiation complex (PIC) has been established, TFIIH is required for promoter opening and promoter escape. Phosphorylation of the C-terminal tail (CTD) of the largest subunit of RNA polymerase II by the kinase module CAK controls the initiation of transcription. XPD/ERCC2 acts by forming a bridge between CAK and the core-TFIIH complex. Involved in the regulation of vitamin-D receptor activity. As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation. Might have a role in aging process and could play a causative role in the generation of skin cancers. {ECO:0000269\|PubMed:10024882, ECO:0000269\|PubMed:15494306, ECO:0000269\|PubMed:20797633, ECO:0000269\|PubMed:8413672}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000528827, ENST00000297720, ENST00000379957, ENST00000523983, ENST00000524874, ENST00000527710, ENST00000519476,	ENST00000221481, ENST00000391940, ENST00000391944, ENST00000391945, ENST00000485403,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	1 X 1 X 1=1	3 X 4 X 3=36
	# samples	1	3
	** MAII score	log2(1/1*10)=3.32192809488736	log2(3/36*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LETM2 [Title/Abstract] AND ERCC2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LETM2 [Title/Abstract] AND ERCC2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LETM2(38262024)-ERCC2(45872405), # samples:2
Anticipated loss of major functional domain due to fusion event.	LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ERCC2	GO:0006283	transcription-coupled nucleotide-excision repair	8663148
Tgene	ERCC2	GO:0006366	transcription by RNA polymerase II	9852112
Tgene	ERCC2	GO:0045893	positive regulation of transcription, DNA-templated	8692842
Tgene	ERCC2	GO:0045944	positive regulation of transcription by RNA polymerase II	8692841

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:38262024/chr19:45872405)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LETM2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ERCC2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000297720	LETM2	chr8	38262024	+	ENST00000391945	ERCC2	chr19	45872405	-	5135	1165	196	3342	1048
ENST00000297720	LETM2	chr8	38262024	+	ENST00000391944	ERCC2	chr19	45872405	-	3135	1165	196	3108	970
ENST00000297720	LETM2	chr8	38262024	+	ENST00000485403	ERCC2	chr19	45872405	-	2451	1165	196	2349	717
ENST00000297720	LETM2	chr8	38262024	+	ENST00000391940	ERCC2	chr19	45872405	-	2350	1165	196	2349	718
ENST00000297720	LETM2	chr8	38262024	+	ENST00000221481	ERCC2	chr19	45872405	-	1788	1165	196	1443	415
ENST00000524874	LETM2	chr8	38262024	+	ENST00000391945	ERCC2	chr19	45872405	-	5171	1201	127	3378	1083
ENST00000524874	LETM2	chr8	38262024	+	ENST00000391944	ERCC2	chr19	45872405	-	3171	1201	127	3144	1005
ENST00000524874	LETM2	chr8	38262024	+	ENST00000485403	ERCC2	chr19	45872405	-	2487	1201	127	2385	752
ENST00000524874	LETM2	chr8	38262024	+	ENST00000391940	ERCC2	chr19	45872405	-	2386	1201	127	2385	753
ENST00000524874	LETM2	chr8	38262024	+	ENST00000221481	ERCC2	chr19	45872405	-	1824	1201	127	1479	450
ENST00000379957	LETM2	chr8	38262024	+	ENST00000391945	ERCC2	chr19	45872405	-	5315	1345	127	3522	1131
ENST00000379957	LETM2	chr8	38262024	+	ENST00000391944	ERCC2	chr19	45872405	-	3315	1345	127	3288	1053
ENST00000379957	LETM2	chr8	38262024	+	ENST00000485403	ERCC2	chr19	45872405	-	2631	1345	127	2529	800
ENST00000379957	LETM2	chr8	38262024	+	ENST00000391940	ERCC2	chr19	45872405	-	2530	1345	127	2529	801
ENST00000379957	LETM2	chr8	38262024	+	ENST00000221481	ERCC2	chr19	45872405	-	1968	1345	127	1623	498
ENST00000523983	LETM2	chr8	38262024	+	ENST00000391945	ERCC2	chr19	45872405	-	5219	1249	136	3426	1096
ENST00000523983	LETM2	chr8	38262024	+	ENST00000391944	ERCC2	chr19	45872405	-	3219	1249	136	3192	1018
ENST00000523983	LETM2	chr8	38262024	+	ENST00000485403	ERCC2	chr19	45872405	-	2535	1249	136	2433	765
ENST00000523983	LETM2	chr8	38262024	+	ENST00000391940	ERCC2	chr19	45872405	-	2434	1249	136	2433	766
ENST00000523983	LETM2	chr8	38262024	+	ENST00000221481	ERCC2	chr19	45872405	-	1872	1249	136	1527	463
ENST00000527710	LETM2	chr8	38262024	+	ENST00000391945	ERCC2	chr19	45872405	-	4703	733	157	2910	917
ENST00000527710	LETM2	chr8	38262024	+	ENST00000391944	ERCC2	chr19	45872405	-	2703	733	157	2676	839
ENST00000527710	LETM2	chr8	38262024	+	ENST00000485403	ERCC2	chr19	45872405	-	2019	733	157	1917	586
ENST00000527710	LETM2	chr8	38262024	+	ENST00000391940	ERCC2	chr19	45872405	-	1918	733	157	1917	587
ENST00000527710	LETM2	chr8	38262024	+	ENST00000221481	ERCC2	chr19	45872405	-	1356	733	157	1011	284

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000297720	ENST00000391945	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.002511913	0.997488
ENST00000297720	ENST00000391944	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.005105723	0.99489427
ENST00000297720	ENST00000485403	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.013727638	0.98627234
ENST00000297720	ENST00000391940	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.014754696	0.9852453
ENST00000297720	ENST00000221481	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.007143834	0.99285614
ENST00000524874	ENST00000391945	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.002229977	0.9977701
ENST00000524874	ENST00000391944	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.004374853	0.9956252
ENST00000524874	ENST00000485403	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.01664628	0.98335373
ENST00000524874	ENST00000391940	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.017517326	0.9824827
ENST00000524874	ENST00000221481	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.016701063	0.98329896
ENST00000379957	ENST00000391945	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.002399993	0.9976
ENST00000379957	ENST00000391944	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.004125802	0.9958742
ENST00000379957	ENST00000485403	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.012049618	0.98795044
ENST00000379957	ENST00000391940	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.012983243	0.98701674
ENST00000379957	ENST00000221481	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.015064913	0.98493505
ENST00000523983	ENST00000391945	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.002563831	0.9974362
ENST00000523983	ENST00000391944	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.004573881	0.9954261
ENST00000523983	ENST00000485403	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.012065391	0.9879346
ENST00000523983	ENST00000391940	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.013504951	0.986495
ENST00000523983	ENST00000221481	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.008979631	0.9910204
ENST00000527710	ENST00000391945	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.002617021	0.99738294
ENST00000527710	ENST00000391944	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.010655447	0.98934454
ENST00000527710	ENST00000485403	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.013524831	0.98647517
ENST00000527710	ENST00000391940	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.014764972	0.985235
ENST00000527710	ENST00000221481	LETM2	chr8	38262024	+	ERCC2	chr19	45872405	-	0.006548031	0.99345195

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LETM2-ERCC2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LETM2	chr8	38262024	ERCC2	chr19	45872405	1165	323	VKPKPIEIPLSGEGHGVLEMPSGTGK
LETM2	chr8	38262024	ERCC2	chr19	45872405	1201	358	VKPKPIEIPLSGEGHGVLEMPSGTGK
LETM2	chr8	38262024	ERCC2	chr19	45872405	1249	371	VKPKPIEIPLSGEGHGVLEMPSGTGK
LETM2	chr8	38262024	ERCC2	chr19	45872405	1345	406	VKPKPIEIPLSGEGHGVLEMPSGTGK
LETM2	chr8	38262024	ERCC2	chr19	45872405	733	192	VKPKPIEIPLSGEGHGVLEMPSGTGK

Top

Potential FusionNeoAntigen Information of LETM2-ERCC2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LETM2-ERCC2_38262024_45872405.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:01	GEGHGVLEM	0.9972	0.7171	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:03	GEGHGVLEM	0.991	0.9899	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B47:01	GEGHGVLEM	0.9091	0.7174	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B39:13	GEGHGVLEM	0.3309	0.988	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B41:02	GEGHGVLEM	0.2124	0.5293	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B48:03	GEGHGVLEM	0.995	0.7437	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:09	GEGHGVLEM	0.9934	0.5399	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-C03:08	LSGEGHGVL	0.9932	0.9697	9	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:10	GEGHGVLEM	0.9868	0.8698	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:03	GEGHGVLEM	0.9743	0.6564	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B39:08	GEGHGVLEM	0.4391	0.9686	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B42:01	IPLSGEGHGVL	0.9902	0.8304	7	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B39:10	IPLSGEGHGVL	0.9664	0.9309	7	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:04	GEGHGVLEM	0.9982	0.8729	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:36	GEGHGVLEM	0.9974	0.7176	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:49	GEGHGVLEM	0.9971	0.7263	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-C03:03	LSGEGHGVL	0.9958	0.9961	9	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-C03:04	LSGEGHGVL	0.9958	0.9961	9	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B40:12	GEGHGVLEM	0.995	0.7437	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:07	GEGHGVLEM	0.991	0.9899	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:13	GEGHGVLEM	0.991	0.9899	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B44:26	GEGHGVLEM	0.991	0.9899	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-C03:06	LSGEGHGVL	0.8578	0.9962	9	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B41:03	GEGHGVLEM	0.37	0.9209	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B15:53	GEGHGVLEM	0.0652	0.9221	11	20
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B55:04	IPLSGEGHGVL	0.9954	0.5949	7	18
LETM2-ERCC2	chr8	38262024	chr19	45872405	1165	HLA-B67:01	IPLSGEGHGVL	0.9546	0.7754	7	18

Top

Potential FusionNeoAntigen Information of LETM2-ERCC2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of LETM2-ERCC2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1801	EIPLSGEGHGVLEM	LETM2	ERCC2	chr8	38262024	chr19	45872405	1165

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LETM2-ERCC2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1801	EIPLSGEGHGVLEM	-7.9962	-8.1096
HLA-B14:02	3BVN	1801	EIPLSGEGHGVLEM	-5.70842	-6.74372
HLA-B52:01	3W39	1801	EIPLSGEGHGVLEM	-6.83737	-6.95077
HLA-B52:01	3W39	1801	EIPLSGEGHGVLEM	-4.4836	-5.5189
HLA-A11:01	4UQ2	1801	EIPLSGEGHGVLEM	-10.0067	-10.1201
HLA-A11:01	4UQ2	1801	EIPLSGEGHGVLEM	-9.03915	-10.0745
HLA-A24:02	5HGA	1801	EIPLSGEGHGVLEM	-6.56204	-6.67544
HLA-A24:02	5HGA	1801	EIPLSGEGHGVLEM	-5.42271	-6.45801
HLA-B44:05	3DX8	1801	EIPLSGEGHGVLEM	-7.85648	-8.89178
HLA-B44:05	3DX8	1801	EIPLSGEGHGVLEM	-5.3978	-5.5112
HLA-A02:01	6TDR	1801	EIPLSGEGHGVLEM	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of LETM2-ERCC2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LETM2-ERCC2	chr8	38262024	chr19	45872405	11	20	GEGHGVLEM	GGGGAGGGTCATGGAGTCCTGGAGATG
LETM2-ERCC2	chr8	38262024	chr19	45872405	7	18	IPLSGEGHGVL	ATACCACTCAGTGGGGAGGGTCATGGAGTCCTG
LETM2-ERCC2	chr8	38262024	chr19	45872405	9	18	LSGEGHGVL	CTCAGTGGGGAGGGTCATGGAGTCCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of LETM2-ERCC2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	LETM2-ERCC2	chr8	38262024	ENST00000297720	chr19	45872405	ENST00000221481	TCGA-85-A53L-01A

Top

Potential target of CAR-T therapy development for LETM2-ERCC2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

LETM2

chr8:38262024

chr19:45872405

ENST00000297720

178_198

311

397.0

Transmembrane

Helical

Hgene

LETM2

chr8:38262024

chr19:45872405

ENST00000379957

178_198

406

492.0

Transmembrane

Helical

Hgene

LETM2

chr8:38262024

chr19:45872405

ENST00000523983

178_198

359

445.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LETM2-ERCC2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LETM2-ERCC2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)