![]() |
|||||||
|
Fusion Protein:LETM2-ERCC2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: LETM2-ERCC2 | FusionPDB ID: 44492 | FusionGDB2.0 ID: 44492 | Hgene | Tgene | Gene symbol | LETM2 | ERCC2 | Gene ID | 137994 | 2068 |
Gene name | leucine zipper and EF-hand containing transmembrane protein 2 | ERCC excision repair 2, TFIIH core complex helicase subunit | |
Synonyms | SLC55A2 | COFS2|EM9|TFIIH|TTD|TTD1|XPD | |
Cytomap | 8p11.23 | 19q13.32 | |
Type of gene | protein-coding | protein-coding | |
Description | LETM1 domain-containing protein LETM2, mitochondrialLETM1 and EF-hand domain-containing protein 2leucine zipper-EF-hand containing transmembrane protein 1-like proteinleucine zipper-EF-hand containing transmembrane protein 2 | general transcription and DNA repair factor IIH helicase subunit XPDBTF2 p80CXPDDNA excision repair protein ERCC-2DNA repair protein complementing XP-D cellsTFIIH 80 kDa subunitTFIIH basal transcription factor complex 80 kDa subunitTFIIH basal tran | |
Modification date | 20200313 | 20200315 | |
UniProtAcc | Q2VYF4 Main function of 5'-partner protein: | P18074 Main function of 5'-partner protein: FUNCTION: ATP-dependent 5'-3' DNA helicase, component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II. In NER, TFIIH acts by opening DNA around the lesion to allow the excision of the damaged oligonucleotide and its replacement by a new DNA fragment. The ATP-dependent helicase activity of XPD/ERCC2 is required for DNA opening. In transcription, TFIIH has an essential role in transcription initiation. When the pre-initiation complex (PIC) has been established, TFIIH is required for promoter opening and promoter escape. Phosphorylation of the C-terminal tail (CTD) of the largest subunit of RNA polymerase II by the kinase module CAK controls the initiation of transcription. XPD/ERCC2 acts by forming a bridge between CAK and the core-TFIIH complex. Involved in the regulation of vitamin-D receptor activity. As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation. Might have a role in aging process and could play a causative role in the generation of skin cancers. {ECO:0000269|PubMed:10024882, ECO:0000269|PubMed:15494306, ECO:0000269|PubMed:20797633, ECO:0000269|PubMed:8413672}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000528827, ENST00000297720, ENST00000379957, ENST00000523983, ENST00000524874, ENST00000527710, ENST00000519476, | ENST00000221481, ENST00000391940, ENST00000391944, ENST00000391945, ENST00000485403, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 1 X 1 X 1=1 | 3 X 4 X 3=36 |
# samples | 1 | 3 | |
** MAII score | log2(1/1*10)=3.32192809488736 | log2(3/36*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: LETM2 [Title/Abstract] AND ERCC2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: LETM2 [Title/Abstract] AND ERCC2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | LETM2(38262024)-ERCC2(45872405), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LETM2-ERCC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ERCC2 | GO:0006283 | transcription-coupled nucleotide-excision repair | 8663148 |
Tgene | ERCC2 | GO:0006366 | transcription by RNA polymerase II | 9852112 |
Tgene | ERCC2 | GO:0045893 | positive regulation of transcription, DNA-templated | 8692842 |
Tgene | ERCC2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 8692841 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:38262024/chr19:45872405) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000297720 | LETM2 | chr8 | 38262024 | + | ENST00000391945 | ERCC2 | chr19 | 45872405 | - | 5135 | 1165 | 196 | 3342 | 1048 |
ENST00000297720 | LETM2 | chr8 | 38262024 | + | ENST00000391944 | ERCC2 | chr19 | 45872405 | - | 3135 | 1165 | 196 | 3108 | 970 |
ENST00000297720 | LETM2 | chr8 | 38262024 | + | ENST00000485403 | ERCC2 | chr19 | 45872405 | - | 2451 | 1165 | 196 | 2349 | 717 |
ENST00000297720 | LETM2 | chr8 | 38262024 | + | ENST00000391940 | ERCC2 | chr19 | 45872405 | - | 2350 | 1165 | 196 | 2349 | 718 |
ENST00000297720 | LETM2 | chr8 | 38262024 | + | ENST00000221481 | ERCC2 | chr19 | 45872405 | - | 1788 | 1165 | 196 | 1443 | 415 |
ENST00000524874 | LETM2 | chr8 | 38262024 | + | ENST00000391945 | ERCC2 | chr19 | 45872405 | - | 5171 | 1201 | 127 | 3378 | 1083 |
ENST00000524874 | LETM2 | chr8 | 38262024 | + | ENST00000391944 | ERCC2 | chr19 | 45872405 | - | 3171 | 1201 | 127 | 3144 | 1005 |
ENST00000524874 | LETM2 | chr8 | 38262024 | + | ENST00000485403 | ERCC2 | chr19 | 45872405 | - | 2487 | 1201 | 127 | 2385 | 752 |
ENST00000524874 | LETM2 | chr8 | 38262024 | + | ENST00000391940 | ERCC2 | chr19 | 45872405 | - | 2386 | 1201 | 127 | 2385 | 753 |
ENST00000524874 | LETM2 | chr8 | 38262024 | + | ENST00000221481 | ERCC2 | chr19 | 45872405 | - | 1824 | 1201 | 127 | 1479 | 450 |
ENST00000379957 | LETM2 | chr8 | 38262024 | + | ENST00000391945 | ERCC2 | chr19 | 45872405 | - | 5315 | 1345 | 127 | 3522 | 1131 |
ENST00000379957 | LETM2 | chr8 | 38262024 | + | ENST00000391944 | ERCC2 | chr19 | 45872405 | - | 3315 | 1345 | 127 | 3288 | 1053 |
ENST00000379957 | LETM2 | chr8 | 38262024 | + | ENST00000485403 | ERCC2 | chr19 | 45872405 | - | 2631 | 1345 | 127 | 2529 | 800 |
ENST00000379957 | LETM2 | chr8 | 38262024 | + | ENST00000391940 | ERCC2 | chr19 | 45872405 | - | 2530 | 1345 | 127 | 2529 | 801 |
ENST00000379957 | LETM2 | chr8 | 38262024 | + | ENST00000221481 | ERCC2 | chr19 | 45872405 | - | 1968 | 1345 | 127 | 1623 | 498 |
ENST00000523983 | LETM2 | chr8 | 38262024 | + | ENST00000391945 | ERCC2 | chr19 | 45872405 | - | 5219 | 1249 | 136 | 3426 | 1096 |
ENST00000523983 | LETM2 | chr8 | 38262024 | + | ENST00000391944 | ERCC2 | chr19 | 45872405 | - | 3219 | 1249 | 136 | 3192 | 1018 |
ENST00000523983 | LETM2 | chr8 | 38262024 | + | ENST00000485403 | ERCC2 | chr19 | 45872405 | - | 2535 | 1249 | 136 | 2433 | 765 |
ENST00000523983 | LETM2 | chr8 | 38262024 | + | ENST00000391940 | ERCC2 | chr19 | 45872405 | - | 2434 | 1249 | 136 | 2433 | 766 |
ENST00000523983 | LETM2 | chr8 | 38262024 | + | ENST00000221481 | ERCC2 | chr19 | 45872405 | - | 1872 | 1249 | 136 | 1527 | 463 |
ENST00000527710 | LETM2 | chr8 | 38262024 | + | ENST00000391945 | ERCC2 | chr19 | 45872405 | - | 4703 | 733 | 157 | 2910 | 917 |
ENST00000527710 | LETM2 | chr8 | 38262024 | + | ENST00000391944 | ERCC2 | chr19 | 45872405 | - | 2703 | 733 | 157 | 2676 | 839 |
ENST00000527710 | LETM2 | chr8 | 38262024 | + | ENST00000485403 | ERCC2 | chr19 | 45872405 | - | 2019 | 733 | 157 | 1917 | 586 |
ENST00000527710 | LETM2 | chr8 | 38262024 | + | ENST00000391940 | ERCC2 | chr19 | 45872405 | - | 1918 | 733 | 157 | 1917 | 587 |
ENST00000527710 | LETM2 | chr8 | 38262024 | + | ENST00000221481 | ERCC2 | chr19 | 45872405 | - | 1356 | 733 | 157 | 1011 | 284 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000297720 | ENST00000391945 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.002511913 | 0.997488 |
ENST00000297720 | ENST00000391944 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.005105723 | 0.99489427 |
ENST00000297720 | ENST00000485403 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.013727638 | 0.98627234 |
ENST00000297720 | ENST00000391940 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.014754696 | 0.9852453 |
ENST00000297720 | ENST00000221481 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.007143834 | 0.99285614 |
ENST00000524874 | ENST00000391945 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.002229977 | 0.9977701 |
ENST00000524874 | ENST00000391944 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.004374853 | 0.9956252 |
ENST00000524874 | ENST00000485403 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.01664628 | 0.98335373 |
ENST00000524874 | ENST00000391940 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.017517326 | 0.9824827 |
ENST00000524874 | ENST00000221481 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.016701063 | 0.98329896 |
ENST00000379957 | ENST00000391945 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.002399993 | 0.9976 |
ENST00000379957 | ENST00000391944 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.004125802 | 0.9958742 |
ENST00000379957 | ENST00000485403 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.012049618 | 0.98795044 |
ENST00000379957 | ENST00000391940 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.012983243 | 0.98701674 |
ENST00000379957 | ENST00000221481 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.015064913 | 0.98493505 |
ENST00000523983 | ENST00000391945 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.002563831 | 0.9974362 |
ENST00000523983 | ENST00000391944 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.004573881 | 0.9954261 |
ENST00000523983 | ENST00000485403 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.012065391 | 0.9879346 |
ENST00000523983 | ENST00000391940 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.013504951 | 0.986495 |
ENST00000523983 | ENST00000221481 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.008979631 | 0.9910204 |
ENST00000527710 | ENST00000391945 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.002617021 | 0.99738294 |
ENST00000527710 | ENST00000391944 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.010655447 | 0.98934454 |
ENST00000527710 | ENST00000485403 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.013524831 | 0.98647517 |
ENST00000527710 | ENST00000391940 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.014764972 | 0.985235 |
ENST00000527710 | ENST00000221481 | LETM2 | chr8 | 38262024 | + | ERCC2 | chr19 | 45872405 | - | 0.006548031 | 0.99345195 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for LETM2-ERCC2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
LETM2 | chr8 | 38262024 | ERCC2 | chr19 | 45872405 | 1165 | 323 | VKPKPIEIPLSGEGHGVLEMPSGTGK |
LETM2 | chr8 | 38262024 | ERCC2 | chr19 | 45872405 | 1201 | 358 | VKPKPIEIPLSGEGHGVLEMPSGTGK |
LETM2 | chr8 | 38262024 | ERCC2 | chr19 | 45872405 | 1249 | 371 | VKPKPIEIPLSGEGHGVLEMPSGTGK |
LETM2 | chr8 | 38262024 | ERCC2 | chr19 | 45872405 | 1345 | 406 | VKPKPIEIPLSGEGHGVLEMPSGTGK |
LETM2 | chr8 | 38262024 | ERCC2 | chr19 | 45872405 | 733 | 192 | VKPKPIEIPLSGEGHGVLEMPSGTGK |
Top |
Potential FusionNeoAntigen Information of LETM2-ERCC2 in HLA I |
![]() |
LETM2-ERCC2_38262024_45872405.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:01 | GEGHGVLEM | 0.9972 | 0.7171 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:03 | GEGHGVLEM | 0.991 | 0.9899 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B47:01 | GEGHGVLEM | 0.9091 | 0.7174 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B39:13 | GEGHGVLEM | 0.3309 | 0.988 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B41:02 | GEGHGVLEM | 0.2124 | 0.5293 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B48:03 | GEGHGVLEM | 0.995 | 0.7437 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:09 | GEGHGVLEM | 0.9934 | 0.5399 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-C03:08 | LSGEGHGVL | 0.9932 | 0.9697 | 9 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:10 | GEGHGVLEM | 0.9868 | 0.8698 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:03 | GEGHGVLEM | 0.9743 | 0.6564 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B39:08 | GEGHGVLEM | 0.4391 | 0.9686 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B42:01 | IPLSGEGHGVL | 0.9902 | 0.8304 | 7 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B39:10 | IPLSGEGHGVL | 0.9664 | 0.9309 | 7 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:04 | GEGHGVLEM | 0.9982 | 0.8729 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:36 | GEGHGVLEM | 0.9974 | 0.7176 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:49 | GEGHGVLEM | 0.9971 | 0.7263 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-C03:03 | LSGEGHGVL | 0.9958 | 0.9961 | 9 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-C03:04 | LSGEGHGVL | 0.9958 | 0.9961 | 9 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B40:12 | GEGHGVLEM | 0.995 | 0.7437 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:07 | GEGHGVLEM | 0.991 | 0.9899 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:13 | GEGHGVLEM | 0.991 | 0.9899 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B44:26 | GEGHGVLEM | 0.991 | 0.9899 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-C03:06 | LSGEGHGVL | 0.8578 | 0.9962 | 9 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B41:03 | GEGHGVLEM | 0.37 | 0.9209 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B15:53 | GEGHGVLEM | 0.0652 | 0.9221 | 11 | 20 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B55:04 | IPLSGEGHGVL | 0.9954 | 0.5949 | 7 | 18 |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 | HLA-B67:01 | IPLSGEGHGVL | 0.9546 | 0.7754 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of LETM2-ERCC2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of LETM2-ERCC2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1801 | EIPLSGEGHGVLEM | LETM2 | ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 1165 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LETM2-ERCC2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1801 | EIPLSGEGHGVLEM | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 1801 | EIPLSGEGHGVLEM | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 1801 | EIPLSGEGHGVLEM | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 1801 | EIPLSGEGHGVLEM | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 1801 | EIPLSGEGHGVLEM | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 1801 | EIPLSGEGHGVLEM | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 1801 | EIPLSGEGHGVLEM | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 1801 | EIPLSGEGHGVLEM | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 1801 | EIPLSGEGHGVLEM | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 1801 | EIPLSGEGHGVLEM | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 1801 | EIPLSGEGHGVLEM | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of LETM2-ERCC2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 11 | 20 | GEGHGVLEM | GGGGAGGGTCATGGAGTCCTGGAGATG |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 7 | 18 | IPLSGEGHGVL | ATACCACTCAGTGGGGAGGGTCATGGAGTCCTG |
LETM2-ERCC2 | chr8 | 38262024 | chr19 | 45872405 | 9 | 18 | LSGEGHGVL | CTCAGTGGGGAGGGTCATGGAGTCCTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of LETM2-ERCC2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUSC | LETM2-ERCC2 | chr8 | 38262024 | ENST00000297720 | chr19 | 45872405 | ENST00000221481 | TCGA-85-A53L-01A |
Top |
Potential target of CAR-T therapy development for LETM2-ERCC2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | LETM2 | chr8:38262024 | chr19:45872405 | ENST00000297720 | + | 7 | 10 | 178_198 | 311 | 397.0 | Transmembrane | Helical |
Hgene | LETM2 | chr8:38262024 | chr19:45872405 | ENST00000379957 | + | 8 | 11 | 178_198 | 406 | 492.0 | Transmembrane | Helical |
Hgene | LETM2 | chr8:38262024 | chr19:45872405 | ENST00000523983 | + | 8 | 11 | 178_198 | 359 | 445.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to LETM2-ERCC2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to LETM2-ERCC2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |