Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LGR6-NAV1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LGR6-NAV1
	FusionPDB ID: 44597
	FusionGDB2.0 ID: 44597
		Hgene	Tgene
	Gene symbol	LGR6	NAV1
	Gene ID	59352	89796
	Gene name	leucine rich repeat containing G protein-coupled receptor 6	neuron navigator 1
	Synonyms	GPCR\|VTS20631	POMFIL3\|STEERIN1\|UNC53H1
	Cytomap	1q32.1	1q32.1
	Type of gene	protein-coding	protein-coding
	Description	leucine-rich repeat-containing G-protein coupled receptor 6gonadotropin receptor	neuron navigator 1pore membrane and/or filament interacting like protein 3unc-53 homolog 1
	Modification date	20200313	20200313
	UniProtAcc	Q9HBX8 Main function of 5'-partner protein: FUNCTION: Receptor for R-spondins that potentiates the canonical Wnt signaling pathway and acts as a marker of multipotent stem cells in the epidermis. Upon binding to R-spondins (RSPO1, RSPO2, RSPO3 or RSPO4), associates with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. In contrast to classical G-protein coupled receptors, does not activate heterotrimeric G-proteins to transduce the signal. May act as a tumor suppressor. {ECO:0000269\|PubMed:21727895, ECO:0000269\|PubMed:22615920}.	Q8NEY1 Main function of 5'-partner protein: FUNCTION: May be involved in neuronal migration. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000255432, ENST00000367278, ENST00000439764, ENST00000308543,	ENST00000469130, ENST00000295624, ENST00000367295, ENST00000367296, ENST00000367297, ENST00000367300, ENST00000367302,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 2 X 3=24	10 X 10 X 4=400
	# samples	8	12
	** MAII score	log2(8/24*10)=1.73696559416621 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(12/400*10)=-1.73696559416621 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LGR6 [Title/Abstract] AND NAV1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LGR6 [Title/Abstract] AND NAV1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LGR6(202205121)-NAV1(201749549), # samples:3
Anticipated loss of major functional domain due to fusion event.	LGR6-NAV1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LGR6-NAV1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LGR6-NAV1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LGR6-NAV1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	LGR6	GO:0030177	positive regulation of Wnt signaling pathway	22615920
Hgene	LGR6	GO:0030335	positive regulation of cell migration	22615920

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:202205121/chr1:201749549)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LGR6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NAV1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367278	LGR6	chr1	202205121	+	ENST00000367302	NAV1	chr1	201749549	+	8157	517	89	4744	1551
ENST00000367278	LGR6	chr1	202205121	+	ENST00000367296	NAV1	chr1	201749549	+	11962	517	89	4924	1611
ENST00000367278	LGR6	chr1	202205121	+	ENST00000295624	NAV1	chr1	201749549	+	11958	517	89	4915	1608
ENST00000367278	LGR6	chr1	202205121	+	ENST00000367297	NAV1	chr1	201749549	+	11943	517	89	4900	1603
ENST00000367278	LGR6	chr1	202205121	+	ENST00000367300	NAV1	chr1	201749549	+	11787	517	89	4744	1551
ENST00000367278	LGR6	chr1	202205121	+	ENST00000367295	NAV1	chr1	201749549	+	11953	517	89	4915	1608
ENST00000255432	LGR6	chr1	202205121	+	ENST00000367302	NAV1	chr1	201749549	+	7996	356	6	4583	1525
ENST00000255432	LGR6	chr1	202205121	+	ENST00000367296	NAV1	chr1	201749549	+	11801	356	6	4763	1585
ENST00000255432	LGR6	chr1	202205121	+	ENST00000295624	NAV1	chr1	201749549	+	11797	356	6	4754	1582
ENST00000255432	LGR6	chr1	202205121	+	ENST00000367297	NAV1	chr1	201749549	+	11782	356	6	4739	1577
ENST00000255432	LGR6	chr1	202205121	+	ENST00000367300	NAV1	chr1	201749549	+	11626	356	6	4583	1525
ENST00000255432	LGR6	chr1	202205121	+	ENST00000367295	NAV1	chr1	201749549	+	11792	356	6	4754	1582
ENST00000439764	LGR6	chr1	202205121	+	ENST00000367302	NAV1	chr1	201749549	+	7939	299	0	4526	1508
ENST00000439764	LGR6	chr1	202205121	+	ENST00000367296	NAV1	chr1	201749549	+	11744	299	0	4706	1568
ENST00000439764	LGR6	chr1	202205121	+	ENST00000295624	NAV1	chr1	201749549	+	11740	299	0	4697	1565
ENST00000439764	LGR6	chr1	202205121	+	ENST00000367297	NAV1	chr1	201749549	+	11725	299	0	4682	1560
ENST00000439764	LGR6	chr1	202205121	+	ENST00000367300	NAV1	chr1	201749549	+	11569	299	0	4526	1508
ENST00000439764	LGR6	chr1	202205121	+	ENST00000367295	NAV1	chr1	201749549	+	11735	299	0	4697	1565

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367278	ENST00000367302	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.002000424	0.9979996
ENST00000367278	ENST00000367296	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000810687	0.9991893
ENST00000367278	ENST00000295624	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.00071953	0.9992805
ENST00000367278	ENST00000367297	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.00084264	0.9991573
ENST00000367278	ENST00000367300	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000698043	0.9993019
ENST00000367278	ENST00000367295	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000719098	0.99928087
ENST00000255432	ENST00000367302	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.001637981	0.998362
ENST00000255432	ENST00000367296	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000679584	0.9993204
ENST00000255432	ENST00000295624	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000596607	0.99940336
ENST00000255432	ENST00000367297	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000702019	0.999298
ENST00000255432	ENST00000367300	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000581446	0.9994186
ENST00000255432	ENST00000367295	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000596772	0.99940324
ENST00000439764	ENST00000367302	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.001554827	0.9984452
ENST00000439764	ENST00000367296	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000638031	0.99936193
ENST00000439764	ENST00000295624	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000560278	0.99943966
ENST00000439764	ENST00000367297	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000659608	0.99934036
ENST00000439764	ENST00000367300	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000544927	0.99945503
ENST00000439764	ENST00000367295	LGR6	chr1	202205121	+	NAV1	chr1	201749549	+	0.000560553	0.9994394

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LGR6-NAV1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LGR6	chr1	202205121	NAV1	chr1	201749549	299	100	AEALWELPSLQSLWDESSSISSGLSD
LGR6	chr1	202205121	NAV1	chr1	201749549	356	117	AEALWELPSLQSLWDESSSISSGLSD
LGR6	chr1	202205121	NAV1	chr1	201749549	517	143	AEALWELPSLQSLWDESSSISSGLSD

Top

Potential FusionNeoAntigen Information of LGR6-NAV1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LGR6-NAV1_202205121_201749549.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B53:01	LPSLQSLW	0.9396	0.6835	6	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:13	SLWDESSSI	0.9931	0.6647	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:27	SLWDESSSI	0.9919	0.5462	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:11	SLWDESSSI	0.9892	0.7051	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:67	SLWDESSSI	0.989	0.6809	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:24	SLWDESSSI	0.989	0.6809	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:30	SLWDESSSI	0.989	0.6809	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:60	SLWDESSSI	0.9889	0.6461	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:21	SLWDESSSI	0.9876	0.7905	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:16	SLWDESSSI	0.9862	0.5725	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:38	SLWDESSSI	0.9858	0.5593	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:04	SLWDESSSI	0.9823	0.608	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:35	SLWDESSSI	0.9668	0.7314	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:29	SLWDESSSI	0.9407	0.6859	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:20	SLWDESSSI	0.9243	0.6902	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A32:13	ELPSLQSLW	0.8507	0.9955	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A26:14	ELPSLQSLW	0.8421	0.6992	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A26:15	ELPSLQSLW	0.8421	0.6992	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B53:01	ELPSLQSLW	0.8029	0.6164	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A24:14	ELPSLQSLW	0.4727	0.7292	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B13:02	SLWDESSSI	0.1685	0.5059	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B13:01	SLWDESSSI	0.1461	0.9483	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B52:01	SLWDESSSI	0.0768	0.9595	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:03	WELPSLQSLW	0.9982	0.9918	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:02	WELPSLQSLW	0.9972	0.6996	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:05	WELPSLQSLW	0.9854	0.8545	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A24:17	LWELPSLQSLW	0.9989	0.8964	3	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:30	LQSLWDESSSI	0.5993	0.516	9	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:67	LQSLWDESSSI	0.5993	0.516	9	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:24	LQSLWDESSSI	0.5993	0.516	9	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:29	LQSLWDESSSI	0.5252	0.5214	9	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C04:07	LWDESSSI	0.9999	0.791	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C04:10	LWDESSSI	0.9999	0.7694	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C04:14	LWDESSSI	0.9803	0.8325	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:07	SLWDESSSI	0.9897	0.678	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:01	SLWDESSSI	0.989	0.6809	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A26:01	ELPSLQSLW	0.8421	0.6992	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:08	ELPSLQSLW	0.3401	0.6689	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:09	WELPSLQSLW	0.9928	0.8488	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:08	WELPSLQSLW	0.9923	0.7914	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:10	WELPSLQSLW	0.8168	0.8932	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:01	LQSLWDESSSI	0.5993	0.516	9	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C04:01	LWDESSSI	0.9999	0.791	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C18:01	LWDESSSI	0.9998	0.8078	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-C04:04	LWDESSSI	0.9948	0.9045	12	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B53:02	LPSLQSLW	0.9587	0.6753	6	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B51:06	LPSLQSLW	0.9013	0.6378	6	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:03	SLWDESSSI	0.9959	0.7322	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:14	SLWDESSSI	0.9889	0.6654	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A02:06	SLWDESSSI	0.9876	0.7905	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-A25:01	ELPSLQSLW	0.9774	0.9347	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B15:73	SLWDESSSI	0.9511	0.7803	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B15:30	SLWDESSSI	0.9344	0.7832	11	20
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B15:13	ELPSLQSLW	0.8039	0.8621	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B53:02	ELPSLQSLW	0.661	0.7508	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B15:24	ELPSLQSLW	0.4981	0.9497	5	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:07	WELPSLQSLW	0.9982	0.9918	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:26	WELPSLQSLW	0.9982	0.9918	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:13	WELPSLQSLW	0.9982	0.9918	4	14
LGR6-NAV1	chr1	202205121	chr1	201749549	356	HLA-B44:22	WELPSLQSLW	0.9972	0.6996	4	14

Top

Potential FusionNeoAntigen Information of LGR6-NAV1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of LGR6-NAV1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5421	LPSLQSLWDESSSI	LGR6	NAV1	chr1	202205121	chr1	201749549	356

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LGR6-NAV1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5421	LPSLQSLWDESSSI	-7.14368	-7.25548
HLA-B14:02	3BVN	5421	LPSLQSLWDESSSI	-6.90724	-7.95034
HLA-B52:01	3W39	5421	LPSLQSLWDESSSI	-7.67666	-8.71976
HLA-B52:01	3W39	5421	LPSLQSLWDESSSI	-5.5221	-5.6339
HLA-A11:01	4UQ2	5421	LPSLQSLWDESSSI	-8.37369	-9.41679
HLA-A11:01	4UQ2	5421	LPSLQSLWDESSSI	-6.26273	-6.37453
HLA-A24:02	5HGA	5421	LPSLQSLWDESSSI	-7.6158	-8.6589
HLA-A24:02	5HGA	5421	LPSLQSLWDESSSI	-5.36701	-5.47881
HLA-B44:05	3DX8	5421	LPSLQSLWDESSSI	-8.09865	-8.21045
HLA-B44:05	3DX8	5421	LPSLQSLWDESSSI	-5.97829	-7.02139

Top

Vaccine Design for the FusionNeoAntigens of LGR6-NAV1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LGR6-NAV1	chr1	202205121	chr1	201749549	11	20	SLWDESSSI	GTCGCTCTGGGATGAAAGCAGCTCCAT
LGR6-NAV1	chr1	202205121	chr1	201749549	12	20	LWDESSSI	GCTCTGGGATGAAAGCAGCTCCAT
LGR6-NAV1	chr1	202205121	chr1	201749549	3	14	LWELPSLQSLW	GCTGTGGGAGCTGCCGAGCCTGCAGTCGCTCTG
LGR6-NAV1	chr1	202205121	chr1	201749549	4	14	WELPSLQSLW	GTGGGAGCTGCCGAGCCTGCAGTCGCTCTG
LGR6-NAV1	chr1	202205121	chr1	201749549	5	14	ELPSLQSLW	GGAGCTGCCGAGCCTGCAGTCGCTCTG
LGR6-NAV1	chr1	202205121	chr1	201749549	6	14	LPSLQSLW	GCTGCCGAGCCTGCAGTCGCTCTG
LGR6-NAV1	chr1	202205121	chr1	201749549	9	20	LQSLWDESSSI	CCTGCAGTCGCTCTGGGATGAAAGCAGCTCCAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of LGR6-NAV1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	LGR6-NAV1	chr1	202205121	ENST00000255432	chr1	201749549	ENST00000295624	TCGA-AJ-A3BF-01A

Top

Potential target of CAR-T therapy development for LGR6-NAV1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LGR6-NAV1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LGR6-NAV1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)