Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LIMK2-RUFY1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LIMK2-RUFY1
	FusionPDB ID: 44725
	FusionGDB2.0 ID: 44725
		Hgene	Tgene
	Gene symbol	LIMK2	RUFY1
	Gene ID	3985	80230
	Gene name	LIM domain kinase 2	RUN and FYVE domain containing 1
	Synonyms	-	RABIP4\|ZFYVE12
	Cytomap	22q12.2	5q35.3
	Type of gene	protein-coding	protein-coding
	Description	LIM domain kinase 2	RUN and FYVE domain-containing protein 1FYVE-finger protein EIP1la-binding protein 1rab4-interacting proteinzinc finger FYVE domain-containing protein 12
	Modification date	20200313	20200327
	UniProtAcc	P53671 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase that plays an essential role in the regulation of actin filament dynamics (PubMed:10436159, PubMed:11018042). Acts downstream of several Rho family GTPase signal transduction pathways (PubMed:10436159, PubMed:11018042). Involved in astral microtubule organization and mitotic spindle orientation during early stages of mitosis by mediating phosphorylation of TPPP (PubMed:22328514). Displays serine/threonine-specific phosphorylation of myelin basic protein and histone (MBP) in vitro (PubMed:8537403). Suppresses ciliogenesis via multiple pathways; phosphorylation of CFL1, suppression of directional trafficking of ciliary vesicles to the ciliary base, and by facilitating YAP1 nuclear localization where it acts as a transcriptional corepressor of the TEAD4 target genes AURKA and PLK1 (PubMed:25849865). {ECO:0000269\|PubMed:10436159, ECO:0000269\|PubMed:11018042, ECO:0000269\|PubMed:22328514, ECO:0000269\|PubMed:25849865, ECO:0000269\|PubMed:8537403}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000331728, ENST00000444929, ENST00000333611, ENST00000340552, ENST00000406516, ENST00000467301,	ENST00000508797, ENST00000319449, ENST00000377001, ENST00000393438, ENST00000437570,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 7 X 7=539	7 X 10 X 6=420
	# samples	13	10
	** MAII score	log2(13/539*10)=-2.05177364972405 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/420*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LIMK2 [Title/Abstract] AND RUFY1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LIMK2 [Title/Abstract] AND RUFY1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LIMK2(31621805)-RUFY1(179007948), # samples:3
Anticipated loss of major functional domain due to fusion event.	LIMK2-RUFY1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIMK2-RUFY1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIMK2-RUFY1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LIMK2-RUFY1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	LIMK2	GO:0006468	protein phosphorylation	22328514
Hgene	LIMK2	GO:0030953	astral microtubule organization	22328514

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr22:31621805/chr5:179007948)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LIMK2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RUFY1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000319449	RUFY1	chr5	179007948	+	1990	246	82	1482	466
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000377001	RUFY1	chr5	179007948	+	2127	246	656	1627	323
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000437570	RUFY1	chr5	179007948	+	1975	246	82	1482	466
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000393438	RUFY1	chr5	179007948	+	1976	246	82	1482	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000319449	RUFY1	chr5	179007948	+	1974	230	66	1466	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000377001	RUFY1	chr5	179007948	+	2111	230	640	1611	323
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000437570	RUFY1	chr5	179007948	+	1959	230	66	1466	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000393438	RUFY1	chr5	179007948	+	1960	230	66	1466	466
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000319449	RUFY1	chr5	179007947	+	1990	246	82	1482	466
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000377001	RUFY1	chr5	179007947	+	2127	246	656	1627	323
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000437570	RUFY1	chr5	179007947	+	1975	246	82	1482	466
ENST00000444929	LIMK2	chr22	31621805	+	ENST00000393438	RUFY1	chr5	179007947	+	1976	246	82	1482	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000319449	RUFY1	chr5	179007947	+	1974	230	66	1466	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000377001	RUFY1	chr5	179007947	+	2111	230	640	1611	323
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000437570	RUFY1	chr5	179007947	+	1959	230	66	1466	466
ENST00000331728	LIMK2	chr22	31621805	+	ENST00000393438	RUFY1	chr5	179007947	+	1960	230	66	1466	466

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000444929	ENST00000319449	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.01137759	0.98862237
ENST00000444929	ENST00000377001	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.01032479	0.9896752
ENST00000444929	ENST00000437570	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.011305202	0.98869485
ENST00000444929	ENST00000393438	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.011325548	0.98867446
ENST00000331728	ENST00000319449	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.01098812	0.9890119
ENST00000331728	ENST00000377001	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.009226992	0.9907731
ENST00000331728	ENST00000437570	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.010911469	0.98908854
ENST00000331728	ENST00000393438	LIMK2	chr22	31621805	+	RUFY1	chr5	179007948	+	0.010899033	0.989101
ENST00000444929	ENST00000319449	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.01137759	0.98862237
ENST00000444929	ENST00000377001	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.01032479	0.9896752
ENST00000444929	ENST00000437570	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.011305202	0.98869485
ENST00000444929	ENST00000393438	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.011325548	0.98867446
ENST00000331728	ENST00000319449	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.01098812	0.9890119
ENST00000331728	ENST00000377001	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.009226992	0.9907731
ENST00000331728	ENST00000437570	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.010911469	0.98908854
ENST00000331728	ENST00000393438	LIMK2	chr22	31621805	+	RUFY1	chr5	179007947	+	0.010899033	0.989101

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LIMK2-RUFY1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LIMK2	chr22	31621805	RUFY1	chr5	179007947	230	54	YRTVNETWHGSCFRHERITDVLDQKN
LIMK2	chr22	31621805	RUFY1	chr5	179007947	246	54	YRTVNETWHGSCFRHERITDVLDQKN
LIMK2	chr22	31621805	RUFY1	chr5	179007948	230	54	YRTVNETWHGSCFRHERITDVLDQKN
LIMK2	chr22	31621805	RUFY1	chr5	179007948	246	54	YRTVNETWHGSCFRHERITDVLDQKN

Top

Potential FusionNeoAntigen Information of LIMK2-RUFY1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LIMK2-RUFY1_31621805_179007947.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-A66:01	ETWHGSCFR	0.9966	0.6053	5	14
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:02	FRHERITDV	0.9926	0.6331	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:01	FRHERITDV	0.9926	0.6331	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:06	FRHERITDV	0.9911	0.7155	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-A26:03	ETWHGSCFR	0.9174	0.6263	5	14
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:01	FRHERITDVL	0.9974	0.7318	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:06	FRHERITDVL	0.9955	0.6234	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B38:01	FRHERITDVL	0.9929	0.8784	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B38:02	FRHERITDVL	0.9924	0.8896	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:01	FRHERITDVL	0.9798	0.5665	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:02	FRHERITDVL	0.9798	0.5665	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B73:01	FRHERITDV	0.99	0.6249	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:05	FRHERITDV	0.9763	0.9278	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:12	FRHERITDV	0.9746	0.7477	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:27	FRHERITDV	0.882	0.9184	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:95	FRHERITDV	0.8302	0.6435	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:10	FRHERITDV	0.749	0.9227	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:13	FRHERITDV	0.7323	0.8369	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:67	FRHERITDV	0.731	0.9128	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:80	FRHERITDV	0.731	0.9128	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:46	FRHERITDV	0.7113	0.8462	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:19	FRHERITDV	0.6846	0.6895	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:29	FRHERITDV	0.6731	0.9121	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:03	FRHERITDV	0.3681	0.5861	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C12:16	FRHERITDV	0.0216	0.9072	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:12	FRHERITDVL	0.9965	0.7411	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:05	FRHERITDVL	0.9953	0.9438	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:46	FRHERITDVL	0.9937	0.8547	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:05	FRHERITDVL	0.9937	0.7162	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:13	FRHERITDVL	0.9925	0.8494	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:95	FRHERITDVL	0.9916	0.6466	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:27	FRHERITDVL	0.9896	0.937	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:29	FRHERITDVL	0.9884	0.9139	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C12:16	FRHERITDVL	0.9565	0.9224	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B14:03	FRHERITDVL	0.9466	0.6743	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B27:06	FRHERITDV	0.9977	0.678	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:01	FRHERITDV	0.8529	0.6009	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:08	FRHERITDV	0.7585	0.9729	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:17	FRHERITDV	0.7567	0.9283	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:02	FRHERITDV	0.731	0.9128	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:04	FRHERITDV	0.6534	0.8253	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:22	FRHERITDV	0.6023	0.5782	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:02	FRHERITDV	0.1216	0.9843	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:17	FRHERITDV	0.1216	0.9843	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:06	FRHERITDV	0.0805	0.9827	12	21
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B27:06	FRHERITDVL	0.9982	0.6407	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:31	FRHERITDVL	0.9977	0.7345	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B27:09	FRHERITDVL	0.9973	0.8117	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B38:05	FRHERITDVL	0.9929	0.8784	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:01	FRHERITDVL	0.9918	0.6229	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C07:22	FRHERITDVL	0.9865	0.6458	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:08	FRHERITDVL	0.982	0.9788	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:17	FRHERITDVL	0.9606	0.9837	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-C06:02	FRHERITDVL	0.9606	0.9837	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B39:11	FRHERITDVL	0.9567	0.527	12	22
LIMK2-RUFY1	chr22	31621805	chr5	179007947	230	HLA-B15:09	FRHERITDVL	0.9457	0.533	12	22

Top

Potential FusionNeoAntigen Information of LIMK2-RUFY1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of LIMK2-RUFY1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9748	TWHGSCFRHERITD	LIMK2	RUFY1	chr22	31621805	chr5	179007947	230

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LIMK2-RUFY1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9748	TWHGSCFRHERITD	-6.80686	-6.92026
HLA-B14:02	3BVN	9748	TWHGSCFRHERITD	-5.01234	-6.04764
HLA-B52:01	3W39	9748	TWHGSCFRHERITD	-6.71251	-6.82591
HLA-B52:01	3W39	9748	TWHGSCFRHERITD	-4.13165	-5.16695
HLA-A11:01	4UQ2	9748	TWHGSCFRHERITD	-4.31699	-4.43039
HLA-A11:01	4UQ2	9748	TWHGSCFRHERITD	-4.19959	-5.23489
HLA-A24:02	5HGA	9748	TWHGSCFRHERITD	-7.74913	-7.86253
HLA-A24:02	5HGA	9748	TWHGSCFRHERITD	-5.75888	-6.79418
HLA-B27:03	6PZ5	9748	TWHGSCFRHERITD	10001	10000
HLA-B44:05	3DX8	9748	TWHGSCFRHERITD	-4.89721	-5.01061
HLA-B44:05	3DX8	9748	TWHGSCFRHERITD	-3.74482	-4.78012
HLA-A02:01	6TDR	9748	TWHGSCFRHERITD	-5.01451	-6.04981

Top

Vaccine Design for the FusionNeoAntigens of LIMK2-RUFY1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LIMK2-RUFY1	chr22	31621805	chr5	179007947	12	21	FRHERITDV	CCGGCATGAAAGAATTACTGATGTCCT
LIMK2-RUFY1	chr22	31621805	chr5	179007947	12	22	FRHERITDVL	CCGGCATGAAAGAATTACTGATGTCCTTGA
LIMK2-RUFY1	chr22	31621805	chr5	179007947	5	14	ETWHGSCFR	AACCTGGCACGGCTCTTGCTTCCGGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of LIMK2-RUFY1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	LIMK2-RUFY1	chr22	31621805	ENST00000331728	chr5	179007947	ENST00000319449	TCGA-A8-A07O

Top

Potential target of CAR-T therapy development for LIMK2-RUFY1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LIMK2-RUFY1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LIMK2-RUFY1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)