![]() |
|||||||
|
Fusion Protein:LIPC-TCF12 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: LIPC-TCF12 | FusionPDB ID: 45627 | FusionGDB2.0 ID: 45627 | Hgene | Tgene | Gene symbol | LIPC | TCF12 | Gene ID | 3990 | 6938 |
Gene name | lipase C, hepatic type | transcription factor 12 | |
Synonyms | HDLCQ12|HL|HTGL|LIPH | CRS3|HEB|HTF4|HsT17266|TCF-12|bHLHb20|p64 | |
Cytomap | 15q21.3 | 15q21.3 | |
Type of gene | protein-coding | protein-coding | |
Description | hepatic triacylglycerol lipaseTriacylglycerol lipasehepatic lipaselipase member Clipase, hepatic | transcription factor 12DNA-binding protein HTF4E-box-binding proteinclass B basic helix-loop-helix protein 20helix-loop-helix transcription factor 4transcription factor HTF-4 | |
Modification date | 20200322 | 20200313 | |
UniProtAcc | P11150 Main function of 5'-partner protein: FUNCTION: Catalyzes the hydrolysis of triglycerides and phospholipids present in circulating plasma lipoproteins, including chylomicrons, intermediate density lipoproteins (IDL), low density lipoproteins (LDL) of large size and high density lipoproteins (HDL), releasing free fatty acids (FFA) and smaller lipoprotein particles (PubMed:7592706, PubMed:8798474, PubMed:12032167, PubMed:26193433). Also exhibits lysophospholipase activity (By similarity). Can hydrolyze both neutral lipid and phospholipid substrates but shows a greater binding affinity for neutral lipid substrates than phospholipid substrates (By similarity). In native LDL, preferentially hydrolyzes the phosphatidylcholine species containing polyunsaturated fatty acids at sn-2 position (PubMed:26193433). {ECO:0000250|UniProtKB:P07867, ECO:0000269|PubMed:12032167, ECO:0000269|PubMed:26193433, ECO:0000269|PubMed:7592706, ECO:0000269|PubMed:8798474}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000299022, ENST00000356113, ENST00000414170, ENST00000433326, | ENST00000343827, ENST00000537840, ENST00000543579, ENST00000559703, ENST00000559710, ENST00000560764, ENST00000267811, ENST00000333725, ENST00000438423, ENST00000452095, ENST00000557843, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 3 X 3=36 | 21 X 22 X 8=3696 |
# samples | 4 | 26 | |
** MAII score | log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(26/3696*10)=-3.8293812283876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: LIPC [Title/Abstract] AND TCF12 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: LIPC [Title/Abstract] AND TCF12 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | LIPC(58724319)-TCF12(57458600), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | LIPC-TCF12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIPC-TCF12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIPC-TCF12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LIPC-TCF12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | LIPC | GO:0006633 | fatty acid biosynthetic process | 182536 |
Hgene | LIPC | GO:0019433 | triglyceride catabolic process | 182536|2839510|8640403 |
Hgene | LIPC | GO:0034372 | very-low-density lipoprotein particle remodeling | 8640403 |
Tgene | TCF12 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 11802795 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:58724319/chr15:57458600) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000356113 | LIPC | chr15 | 58724319 | + | ENST00000438423 | TCF12 | chr15 | 57458600 | + | 4868 | 703 | 615 | 2498 | 627 |
ENST00000356113 | LIPC | chr15 | 58724319 | + | ENST00000267811 | TCF12 | chr15 | 57458600 | + | 6135 | 703 | 615 | 2426 | 603 |
ENST00000356113 | LIPC | chr15 | 58724319 | + | ENST00000452095 | TCF12 | chr15 | 57458600 | + | 4868 | 703 | 615 | 2498 | 627 |
ENST00000356113 | LIPC | chr15 | 58724319 | + | ENST00000333725 | TCF12 | chr15 | 57458600 | + | 4862 | 703 | 615 | 2498 | 627 |
ENST00000356113 | LIPC | chr15 | 58724319 | + | ENST00000557843 | TCF12 | chr15 | 57458600 | + | 4367 | 703 | 615 | 2426 | 603 |
ENST00000414170 | LIPC | chr15 | 58724319 | + | ENST00000438423 | TCF12 | chr15 | 57458600 | + | 4540 | 375 | 287 | 2170 | 627 |
ENST00000414170 | LIPC | chr15 | 58724319 | + | ENST00000267811 | TCF12 | chr15 | 57458600 | + | 5807 | 375 | 287 | 2098 | 603 |
ENST00000414170 | LIPC | chr15 | 58724319 | + | ENST00000452095 | TCF12 | chr15 | 57458600 | + | 4540 | 375 | 287 | 2170 | 627 |
ENST00000414170 | LIPC | chr15 | 58724319 | + | ENST00000333725 | TCF12 | chr15 | 57458600 | + | 4534 | 375 | 287 | 2170 | 627 |
ENST00000414170 | LIPC | chr15 | 58724319 | + | ENST00000557843 | TCF12 | chr15 | 57458600 | + | 4039 | 375 | 287 | 2098 | 603 |
ENST00000299022 | LIPC | chr15 | 58724319 | + | ENST00000438423 | TCF12 | chr15 | 57458600 | + | 4488 | 323 | 235 | 2118 | 627 |
ENST00000299022 | LIPC | chr15 | 58724319 | + | ENST00000267811 | TCF12 | chr15 | 57458600 | + | 5755 | 323 | 235 | 2046 | 603 |
ENST00000299022 | LIPC | chr15 | 58724319 | + | ENST00000452095 | TCF12 | chr15 | 57458600 | + | 4488 | 323 | 235 | 2118 | 627 |
ENST00000299022 | LIPC | chr15 | 58724319 | + | ENST00000333725 | TCF12 | chr15 | 57458600 | + | 4482 | 323 | 235 | 2118 | 627 |
ENST00000299022 | LIPC | chr15 | 58724319 | + | ENST00000557843 | TCF12 | chr15 | 57458600 | + | 3987 | 323 | 235 | 2046 | 603 |
ENST00000433326 | LIPC | chr15 | 58724319 | + | ENST00000438423 | TCF12 | chr15 | 57458600 | + | 4295 | 130 | 42 | 1925 | 627 |
ENST00000433326 | LIPC | chr15 | 58724319 | + | ENST00000267811 | TCF12 | chr15 | 57458600 | + | 5562 | 130 | 42 | 1853 | 603 |
ENST00000433326 | LIPC | chr15 | 58724319 | + | ENST00000452095 | TCF12 | chr15 | 57458600 | + | 4295 | 130 | 42 | 1925 | 627 |
ENST00000433326 | LIPC | chr15 | 58724319 | + | ENST00000333725 | TCF12 | chr15 | 57458600 | + | 4289 | 130 | 42 | 1925 | 627 |
ENST00000433326 | LIPC | chr15 | 58724319 | + | ENST00000557843 | TCF12 | chr15 | 57458600 | + | 3794 | 130 | 42 | 1853 | 603 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000356113 | ENST00000438423 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001697555 | 0.99830246 |
ENST00000356113 | ENST00000267811 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.0008446 | 0.9991554 |
ENST00000356113 | ENST00000452095 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001697555 | 0.99830246 |
ENST00000356113 | ENST00000333725 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001722691 | 0.9982773 |
ENST00000356113 | ENST00000557843 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.003280105 | 0.9967199 |
ENST00000414170 | ENST00000438423 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001687518 | 0.9983125 |
ENST00000414170 | ENST00000267811 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.00085818 | 0.9991418 |
ENST00000414170 | ENST00000452095 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001687518 | 0.9983125 |
ENST00000414170 | ENST00000333725 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001713637 | 0.9982863 |
ENST00000414170 | ENST00000557843 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.003119308 | 0.99688065 |
ENST00000299022 | ENST00000438423 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001173409 | 0.99882656 |
ENST00000299022 | ENST00000267811 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.000663848 | 0.9993362 |
ENST00000299022 | ENST00000452095 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001173409 | 0.99882656 |
ENST00000299022 | ENST00000333725 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001190824 | 0.9988092 |
ENST00000299022 | ENST00000557843 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.002165583 | 0.9978344 |
ENST00000433326 | ENST00000438423 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001466449 | 0.9985335 |
ENST00000433326 | ENST00000267811 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.000739159 | 0.99926084 |
ENST00000433326 | ENST00000452095 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001466449 | 0.9985335 |
ENST00000433326 | ENST00000333725 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.001489868 | 0.99851006 |
ENST00000433326 | ENST00000557843 | LIPC | chr15 | 58724319 | + | TCF12 | chr15 | 57458600 | + | 0.002680139 | 0.9973199 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for LIPC-TCF12 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
LIPC | chr15 | 58724319 | TCF12 | chr15 | 57458600 | 130 | 29 | FIQSSALGQSLKPGKTSERGSFSLYS |
LIPC | chr15 | 58724319 | TCF12 | chr15 | 57458600 | 323 | 29 | FIQSSALGQSLKPGKTSERGSFSLYS |
LIPC | chr15 | 58724319 | TCF12 | chr15 | 57458600 | 375 | 29 | FIQSSALGQSLKPGKTSERGSFSLYS |
LIPC | chr15 | 58724319 | TCF12 | chr15 | 57458600 | 703 | 29 | FIQSSALGQSLKPGKTSERGSFSLYS |
Top |
Potential FusionNeoAntigen Information of LIPC-TCF12 in HLA I |
![]() |
LIPC-TCF12_58724319_57458600.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A31:02 | SLKPGKTSER | 0.9443 | 0.5951 | 9 | 19 |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A74:09 | SLKPGKTSER | 0.9328 | 0.6051 | 9 | 19 |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A74:11 | SLKPGKTSER | 0.9328 | 0.6051 | 9 | 19 |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A74:03 | SLKPGKTSER | 0.9328 | 0.6051 | 9 | 19 |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A31:01 | SLKPGKTSER | 0.9514 | 0.5614 | 9 | 19 |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 | HLA-A74:01 | SLKPGKTSER | 0.9328 | 0.6051 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of LIPC-TCF12 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of LIPC-TCF12 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5022 | LGQSLKPGKTSERG | LIPC | TCF12 | chr15 | 58724319 | chr15 | 57458600 | 323 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LIPC-TCF12 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5022 | LGQSLKPGKTSERG | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 5022 | LGQSLKPGKTSERG | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 5022 | LGQSLKPGKTSERG | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 5022 | LGQSLKPGKTSERG | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 5022 | LGQSLKPGKTSERG | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 5022 | LGQSLKPGKTSERG | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 5022 | LGQSLKPGKTSERG | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 5022 | LGQSLKPGKTSERG | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 5022 | LGQSLKPGKTSERG | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 5022 | LGQSLKPGKTSERG | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 5022 | LGQSLKPGKTSERG | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of LIPC-TCF12 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
LIPC-TCF12 | chr15 | 58724319 | chr15 | 57458600 | 9 | 19 | SLKPGKTSER | GCCTGAAACCAGGAAAAACATCAGAGAGAG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of LIPC-TCF12 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LIHC | LIPC-TCF12 | chr15 | 58724319 | ENST00000299022 | chr15 | 57458600 | ENST00000267811 | TCGA-BD-A3ER-01A |
Top |
Potential target of CAR-T therapy development for LIPC-TCF12 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to LIPC-TCF12 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to LIPC-TCF12 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |