Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ANKRD12-MTHFD2L

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ANKRD12-MTHFD2L
	FusionPDB ID: 4577
	FusionGDB2.0 ID: 4577
		Hgene	Tgene
	Gene symbol	ANKRD12	MTHFD2L
	Gene ID	23253	441024
	Gene name	ankyrin repeat domain 12	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like
	Synonyms	ANCO-2\|ANCO1\|GAC-1\|Nbla00144	-
	Cytomap	18p11.22	4q13.3
	Type of gene	protein-coding	protein-coding
	Description	ankyrin repeat domain-containing protein 12ankyrin repeat-containing cofactor 2	probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2MTHFD2-likeNADP-dependent methylenetetrahydrofolate dehydrogenase 2-like proteintetrahydrofolate dehydrogenase/cyclohydrolase
	Modification date	20200313	20200320
	UniProtAcc	Q6UB98 Main function of 5'-partner protein: FUNCTION: May recruit HDACs to the p160 coactivators/nuclear receptor complex to inhibit ligand-dependent transactivation.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000540578, ENST00000262126, ENST00000383440, ENST00000400020,	ENST00000325278, ENST00000331145, ENST00000395759, ENST00000433372, ENST00000461101,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 12 X 9=1836	6 X 6 X 5=180
	# samples	21	7
	** MAII score	log2(21/1836*10)=-3.12810482574769 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/180*10)=-1.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ANKRD12 [Title/Abstract] AND MTHFD2L [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ANKRD12 [Title/Abstract] AND MTHFD2L [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ANKRD12(9221997)-MTHFD2L(75091019), # samples:3
Anticipated loss of major functional domain due to fusion event.	ANKRD12-MTHFD2L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANKRD12-MTHFD2L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANKRD12-MTHFD2L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ANKRD12-MTHFD2L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr18:9221997/chr4:75091019)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ANKRD12 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MTHFD2L (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091019	+	1855	1131	242	1264	340
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091019	+	1265	1131	242	1264	341
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091019	+	2746	1131	242	1462	406
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091019	+	2753	1131	242	1462	406
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091019	+	1907	1183	225	1316	363
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091019	+	1317	1183	225	1316	363
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091019	+	2798	1183	225	1514	429
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091019	+	2805	1183	225	1514	429
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091019	+	1960	1236	347	1369	340
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091019	+	1370	1236	347	1369	341
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091019	+	2851	1236	347	1567	406
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091019	+	2858	1236	347	1567	406
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091018	+	1855	1131	242	1264	340
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091018	+	1265	1131	242	1264	341
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091018	+	2746	1131	242	1462	406
ENST00000383440	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091018	+	2753	1131	242	1462	406
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091018	+	1907	1183	225	1316	363
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091018	+	1317	1183	225	1316	363
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091018	+	2798	1183	225	1514	429
ENST00000262126	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091018	+	2805	1183	225	1514	429
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000433372	MTHFD2L	chr4	75091018	+	1960	1236	347	1369	340
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000331145	MTHFD2L	chr4	75091018	+	1370	1236	347	1369	341
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000395759	MTHFD2L	chr4	75091018	+	2851	1236	347	1567	406
ENST00000400020	ANKRD12	chr18	9221997	+	ENST00000325278	MTHFD2L	chr4	75091018	+	2858	1236	347	1567	406

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000383440	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000890542	0.99910945
ENST00000383440	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.002536602	0.99746335
ENST00000383440	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000348191	0.9996518
ENST00000383440	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000356122	0.9996439
ENST00000262126	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.00127459	0.99872535
ENST00000262126	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.003846996	0.99615294
ENST00000262126	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000434667	0.9995653
ENST00000262126	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000439038	0.9995609
ENST00000400020	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000813697	0.99918634
ENST00000400020	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.002127643	0.99787235
ENST00000400020	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000310544	0.99968946
ENST00000400020	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091019	+	0.000315083	0.99968493
ENST00000383440	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000890542	0.99910945
ENST00000383440	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.002536602	0.99746335
ENST00000383440	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000348191	0.9996518
ENST00000383440	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000356122	0.9996439
ENST00000262126	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.00127459	0.99872535
ENST00000262126	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.003846996	0.99615294
ENST00000262126	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000434667	0.9995653
ENST00000262126	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000439038	0.9995609
ENST00000400020	ENST00000433372	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000813697	0.99918634
ENST00000400020	ENST00000331145	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.002127643	0.99787235
ENST00000400020	ENST00000395759	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000310544	0.99968946
ENST00000400020	ENST00000325278	ANKRD12	chr18	9221997	+	MTHFD2L	chr4	75091018	+	0.000315083	0.99968493

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ANKRD12-MTHFD2L

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091018	1131	296	REVPLSDDDESYTGDATVTIAHRYTP
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091018	1183	319	REVPLSDDDESYTGDATVTIAHRYTP
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091018	1236	296	REVPLSDDDESYTGDATVTIAHRYTP
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091019	1131	296	REVPLSDDDESYTGDATVTIAHRYTP
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091019	1183	319	REVPLSDDDESYTGDATVTIAHRYTP
ANKRD12	chr18	9221997	MTHFD2L	chr4	75091019	1236	296	REVPLSDDDESYTGDATVTIAHRYTP

Top

Potential FusionNeoAntigen Information of ANKRD12-MTHFD2L in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ANKRD12-MTHFD2L_9221997_75091018.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-B15:16	YTGDATVTI	0.8856	0.6753	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C05:09	YTGDATVTI	0.9988	0.9518	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C03:07	YTGDATVTI	0.9975	0.9627	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C15:06	YTGDATVTI	0.9975	0.8701	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C04:06	YTGDATVTI	0.9962	0.8643	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C03:08	YTGDATVTI	0.9909	0.7509	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C03:19	YTGDATVTI	0.987	0.946	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C08:04	YTGDATVTI	0.9579	0.9234	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C08:13	YTGDATVTI	0.9579	0.9234	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C06:03	YTGDATVTI	0.8449	0.9721	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C12:04	YTGDATVTI	0.8368	0.9762	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-B51:07	ESYTGDATV	0.7296	0.8169	9	18
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C08:03	YTGDATVTI	0.7117	0.9573	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C02:06	YTGDATVTI	0.3444	0.9367	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C05:01	YTGDATVTI	0.9988	0.9518	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C04:03	YTGDATVTI	0.9987	0.9058	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C15:05	YTGDATVTI	0.9975	0.8638	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C15:02	YTGDATVTI	0.9973	0.8721	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C01:03	YTGDATVTI	0.9917	0.8222	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C03:17	YTGDATVTI	0.9864	0.8433	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C03:06	YTGDATVTI	0.9671	0.9478	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C12:03	YTGDATVTI	0.7756	0.9369	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C08:01	YTGDATVTI	0.7117	0.9573	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-C17:01	YTGDATVTI	0.4821	0.8913	11	20
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	HLA-B07:13	YTGDATVTI	0.0183	0.7019	11	20

Top

Potential FusionNeoAntigen Information of ANKRD12-MTHFD2L in HLA II

ANKRD12-MTHFD2L_9221997_75091018.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0305	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0338	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0338	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0401	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0433	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0434	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0435	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0438	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0462	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0462	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0463	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0464	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0466	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0472	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0472	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB1-0476	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0101	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0101	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0101	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0101	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0104	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0104	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0104	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0104	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0105	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0105	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0105	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0105	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0108	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0108	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0108	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0108	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0109	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0109	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0109	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0109	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0111	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0111	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0111	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0111	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0112	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0112	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0112	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0112	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0113	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0113	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0113	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0113	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0114	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0114	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0114	DDDESYTGDATVTIA	6	21
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0114	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0209	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0209	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0212	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0213	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0215	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0216	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0216	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0219	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0221	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0221	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0222	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0303	DESYTGDATVTIAHR	8	23
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0303	DDESYTGDATVTIAH	7	22
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0303	ESYTGDATVTIAHRY	9	24
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	1183	DRB3-0303	DDDESYTGDATVTIA	6	21

Top

Fusion breakpoint peptide structures of ANKRD12-MTHFD2L

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1021	DDDESYTGDATVTI	ANKRD12	MTHFD2L	chr18	9221997	chr4	75091018	1183

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ANKRD12-MTHFD2L

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1021	DDDESYTGDATVTI	-7.15543	-7.26883
HLA-B14:02	3BVN	1021	DDDESYTGDATVTI	-4.77435	-5.80965
HLA-B52:01	3W39	1021	DDDESYTGDATVTI	-6.80875	-6.92215
HLA-B52:01	3W39	1021	DDDESYTGDATVTI	-4.20386	-5.23916
HLA-A11:01	4UQ2	1021	DDDESYTGDATVTI	-7.5194	-8.5547
HLA-A11:01	4UQ2	1021	DDDESYTGDATVTI	-6.9601	-7.0735
HLA-A24:02	5HGA	1021	DDDESYTGDATVTI	-7.52403	-7.63743
HLA-A24:02	5HGA	1021	DDDESYTGDATVTI	-5.82433	-6.85963
HLA-B27:05	6PYJ	1021	DDDESYTGDATVTI	-3.28285	-4.31815
HLA-B44:05	3DX8	1021	DDDESYTGDATVTI	-5.91172	-6.94702
HLA-B44:05	3DX8	1021	DDDESYTGDATVTI	-4.24346	-4.35686
HLA-B35:01	1A1N	1021	DDDESYTGDATVTI	-5.9251	-6.0385
HLA-B35:01	1A1N	1021	DDDESYTGDATVTI	-4.80237	-5.83767

Top

Vaccine Design for the FusionNeoAntigens of ANKRD12-MTHFD2L

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	11	20	YTGDATVTI	ACACAGGTGATGCAACTGTGACAATAG
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	9	18	ESYTGDATV	AAAGTTACACAGGTGATGCAACTGTGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	6	21	DDDESYTGDATVTIA	ATGATGATGAAAGTTACACAGGTGATGCAACTGTGACAATAGCTC
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	7	22	DDESYTGDATVTIAH	ATGATGAAAGTTACACAGGTGATGCAACTGTGACAATAGCTCACA
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	8	23	DESYTGDATVTIAHR	ATGAAAGTTACACAGGTGATGCAACTGTGACAATAGCTCACAGAT
ANKRD12-MTHFD2L	chr18	9221997	chr4	75091018	9	24	ESYTGDATVTIAHRY	AAAGTTACACAGGTGATGCAACTGTGACAATAGCTCACAGATACA

Top

Information of the samples that have these potential fusion neoantigens of ANKRD12-MTHFD2L

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	ANKRD12-MTHFD2L	chr18	9221997	ENST00000262126	chr4	75091018	ENST00000325278	TCGA-A2-A4S3

Top

Potential target of CAR-T therapy development for ANKRD12-MTHFD2L

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ANKRD12-MTHFD2L

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ANKRD12-MTHFD2L

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)