|
|||||||
|
Fusion Protein:ABL1-NTRK2 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ABL1-NTRK2 | FusionPDB ID: 490 | FusionGDB2.0 ID: 490 | Hgene | Tgene | Gene symbol | ABL1 | NTRK2 | Gene ID | 25 | 4915 |
| Gene name | ABL proto-oncogene 1, non-receptor tyrosine kinase | neurotrophic receptor tyrosine kinase 2 | |
| Synonyms | ABL|BCR-ABL|CHDSKM|JTK7|bcr/abl|c-ABL|c-ABL1|p150|v-abl | EIEE58|GP145-TrkB|OBHD|TRKB|trk-B | |
| Cytomap | 9q34.12 | 9q21.33 | |
| Type of gene | protein-coding | protein-coding | |
| Description | tyrosine-protein kinase ABL1ABL protooncogene 1 nonreceptor tyrosine kinaseAbelson tyrosine-protein kinase 1bcr/c-abl oncogene proteinc-abl oncogene 1, receptor tyrosine kinaseproto-oncogene c-Ablproto-oncogene tyrosine-protein kinase ABL1truncated | BDNF/NT-3 growth factors receptorBDNF-tropomyosine receptor kinase Bneurotrophic tyrosine kinase receptor type 2tropomyosin-related kinase Btyrosine kinase receptor B | |
| Modification date | 20200327 | 20200313 | |
| UniProtAcc | P00519 Main function of 5'-partner protein: FUNCTION: Non-receptor tyrosine-protein kinase that plays a role in many key processes linked to cell growth and survival such as cytoskeleton remodeling in response to extracellular stimuli, cell motility and adhesion, receptor endocytosis, autophagy, DNA damage response and apoptosis. Coordinates actin remodeling through tyrosine phosphorylation of proteins controlling cytoskeleton dynamics like WASF3 (involved in branch formation); ANXA1 (involved in membrane anchoring); DBN1, DBNL, CTTN, RAPH1 and ENAH (involved in signaling); or MAPT and PXN (microtubule-binding proteins). Phosphorylation of WASF3 is critical for the stimulation of lamellipodia formation and cell migration. Involved in the regulation of cell adhesion and motility through phosphorylation of key regulators of these processes such as BCAR1, CRK, CRKL, DOK1, EFS or NEDD9. Phosphorylates multiple receptor tyrosine kinases and more particularly promotes endocytosis of EGFR, facilitates the formation of neuromuscular synapses through MUSK, inhibits PDGFRB-mediated chemotaxis and modulates the endocytosis of activated B-cell receptor complexes. Other substrates which are involved in endocytosis regulation are the caveolin (CAV1) and RIN1. Moreover, ABL1 regulates the CBL family of ubiquitin ligases that drive receptor down-regulation and actin remodeling. Phosphorylation of CBL leads to increased EGFR stability. Involved in late-stage autophagy by regulating positively the trafficking and function of lysosomal components. ABL1 targets to mitochondria in response to oxidative stress and thereby mediates mitochondrial dysfunction and cell death. In response to oxidative stress, phosphorylates serine/threonine kinase PRKD2 at 'Tyr-717' (PubMed:28428613). ABL1 is also translocated in the nucleus where it has DNA-binding activity and is involved in DNA-damage response and apoptosis. Many substrates are known mediators of DNA repair: DDB1, DDB2, ERCC3, ERCC6, RAD9A, RAD51, RAD52 or WRN. Activates the proapoptotic pathway when the DNA damage is too severe to be repaired. Phosphorylates TP73, a primary regulator for this type of damage-induced apoptosis. Phosphorylates the caspase CASP9 on 'Tyr-153' and regulates its processing in the apoptotic response to DNA damage. Phosphorylates PSMA7 that leads to an inhibition of proteasomal activity and cell cycle transition blocks. ABL1 acts also as a regulator of multiple pathological signaling cascades during infection. Several known tyrosine-phosphorylated microbial proteins have been identified as ABL1 substrates. This is the case of A36R of Vaccinia virus, Tir (translocated intimin receptor) of pathogenic E.coli and possibly Citrobacter, CagA (cytotoxin-associated gene A) of H.pylori, or AnkA (ankyrin repeat-containing protein A) of A.phagocytophilum. Pathogens can highjack ABL1 kinase signaling to reorganize the host actin cytoskeleton for multiple purposes, like facilitating intracellular movement and host cell exit. Finally, functions as its own regulator through autocatalytic activity as well as through phosphorylation of its inhibitor, ABI1. Regulates T-cell differentiation in a TBX21-dependent manner. Phosphorylates TBX21 on tyrosine residues leading to an enhancement of its transcriptional activator activity (By similarity). {ECO:0000250|UniProtKB:P00520, ECO:0000269|PubMed:10391250, ECO:0000269|PubMed:11971963, ECO:0000269|PubMed:12379650, ECO:0000269|PubMed:12531427, ECO:0000269|PubMed:12672821, ECO:0000269|PubMed:15031292, ECO:0000269|PubMed:15556646, ECO:0000269|PubMed:15657060, ECO:0000269|PubMed:15886098, ECO:0000269|PubMed:16424036, ECO:0000269|PubMed:16678104, ECO:0000269|PubMed:16943190, ECO:0000269|PubMed:17306540, ECO:0000269|PubMed:17623672, ECO:0000269|PubMed:18328268, ECO:0000269|PubMed:18945674, ECO:0000269|PubMed:19891780, ECO:0000269|PubMed:20357770, ECO:0000269|PubMed:20417104, ECO:0000269|PubMed:28428613, ECO:0000269|PubMed:9037071, ECO:0000269|PubMed:9144171, ECO:0000269|PubMed:9461559}. | Q16620 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase involved in the development and the maturation of the central and the peripheral nervous systems through regulation of neuron survival, proliferation, migration, differentiation, and synapse formation and plasticity (By similarity). Receptor for BDNF/brain-derived neurotrophic factor and NTF4/neurotrophin-4. Alternatively can also bind NTF3/neurotrophin-3 which is less efficient in activating the receptor but regulates neuron survival through NTRK2 (PubMed:7574684, PubMed:15494731). Upon ligand-binding, undergoes homodimerization, autophosphorylation and activation (PubMed:15494731). Recruits, phosphorylates and/or activates several downstream effectors including SHC1, FRS2, SH2B1, SH2B2 and PLCG1 that regulate distinct overlapping signaling cascades. Through SHC1, FRS2, SH2B1, SH2B2 activates the GRB2-Ras-MAPK cascade that regulates for instance neuronal differentiation including neurite outgrowth. Through the same effectors controls the Ras-PI3 kinase-AKT1 signaling cascade that mainly regulates growth and survival. Through PLCG1 and the downstream protein kinase C-regulated pathways controls synaptic plasticity. Thereby, plays a role in learning and memory by regulating both short term synaptic function and long-term potentiation. PLCG1 also leads to NF-Kappa-B activation and the transcription of genes involved in cell survival. Hence, it is able to suppress anoikis, the apoptosis resulting from loss of cell-matrix interactions. May also play a role in neutrophin-dependent calcium signaling in glial cells and mediate communication between neurons and glia. {ECO:0000250|UniProtKB:P15209, ECO:0000269|PubMed:15494731, ECO:0000269|PubMed:7574684}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000318560, | ENST00000277120, ENST00000304053, ENST00000323115, ENST00000359847, ENST00000376208, ENST00000376213, ENST00000376214, ENST00000395866, ENST00000395882, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 55 X 13=15015 | 10 X 9 X 7=630 |
| # samples | 68 | 10 | |
| ** MAII score | log2(68/15015*10)=-4.46472591830681 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/630*10)=-2.65535182861255 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ABL1 [Title/Abstract] AND NTRK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ABL1 [Title/Abstract] AND NTRK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ABL1(133710912)-NTRK2(87338487), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | ABL1-NTRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABL1-NTRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABL1-NTRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ABL1-NTRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ABL1 | GO:0006974 | cellular response to DNA damage stimulus | 15657060 |
| Hgene | ABL1 | GO:0006975 | DNA damage induced protein phosphorylation | 18280240 |
| Hgene | ABL1 | GO:0018108 | peptidyl-tyrosine phosphorylation | 7590236|9144171|10713049|11121037 |
| Hgene | ABL1 | GO:0038083 | peptidyl-tyrosine autophosphorylation | 10518561 |
| Hgene | ABL1 | GO:0042770 | signal transduction in response to DNA damage | 9037071|15657060 |
| Hgene | ABL1 | GO:0043065 | positive regulation of apoptotic process | 9037071 |
| Hgene | ABL1 | GO:0046777 | protein autophosphorylation | 10713049 |
| Hgene | ABL1 | GO:0050731 | positive regulation of peptidyl-tyrosine phosphorylation | 15657060 |
| Hgene | ABL1 | GO:0051353 | positive regulation of oxidoreductase activity | 12893824 |
| Hgene | ABL1 | GO:0051444 | negative regulation of ubiquitin-protein transferase activity | 20823226 |
| Hgene | ABL1 | GO:0070301 | cellular response to hydrogen peroxide | 10713049 |
| Hgene | ABL1 | GO:0071103 | DNA conformation change | 9558345 |
| Hgene | ABL1 | GO:0071901 | negative regulation of protein serine/threonine kinase activity | 11121037 |
| Hgene | ABL1 | GO:1990051 | activation of protein kinase C activity | 10713049 |
| Hgene | ABL1 | GO:2001020 | regulation of response to DNA damage stimulus | 9461559 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:133710912/chr9:87338487) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across ABL1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across NTRK2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000376214 | NTRK2 | chr9 | 87338487 | + | 4547 | 460 | 270 | 2393 | 707 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000376213 | NTRK2 | chr9 | 87338487 | + | 4499 | 460 | 270 | 2345 | 691 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000395882 | NTRK2 | chr9 | 87338487 | + | 6438 | 460 | 270 | 1310 | 346 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000304053 | NTRK2 | chr9 | 87338487 | + | 7620 | 460 | 270 | 1538 | 422 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000376208 | NTRK2 | chr9 | 87338487 | + | 7572 | 460 | 270 | 1490 | 406 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000277120 | NTRK2 | chr9 | 87338487 | + | 3451 | 460 | 270 | 2393 | 707 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000323115 | NTRK2 | chr9 | 87338487 | + | 3232 | 460 | 270 | 2345 | 691 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000359847 | NTRK2 | chr9 | 87338487 | + | 6434 | 460 | 270 | 1310 | 346 |
| ENST00000318560 | ABL1 | chr9 | 133710912 | + | ENST00000395866 | NTRK2 | chr9 | 87338487 | + | 1795 | 460 | 270 | 1310 | 346 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000318560 | ENST00000376214 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.001360544 | 0.9986394 |
| ENST00000318560 | ENST00000376213 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.001598528 | 0.99840146 |
| ENST00000318560 | ENST00000395882 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.000853147 | 0.9991468 |
| ENST00000318560 | ENST00000304053 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.000686133 | 0.99931383 |
| ENST00000318560 | ENST00000376208 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.000733911 | 0.9992661 |
| ENST00000318560 | ENST00000277120 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.001891209 | 0.99810874 |
| ENST00000318560 | ENST00000323115 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.00228449 | 0.9977155 |
| ENST00000318560 | ENST00000359847 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.000815442 | 0.99918455 |
| ENST00000318560 | ENST00000395866 | ABL1 | chr9 | 133710912 | + | NTRK2 | chr9 | 87338487 | + | 0.000670847 | 0.9993292 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ABL1-NTRK2 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ABL1 | chr9 | 133710912 | NTRK2 | chr9 | 87338487 | 460 | 63 | KKGLSSSSSCYLEGLPSANLAAPNLT |
Top |
Potential FusionNeoAntigen Information of ABL1-NTRK2 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ABL1-NTRK2_133710912_87338487.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-A02:60 | YLEGLPSA | 0.995 | 0.8461 | 10 | 18 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-A02:38 | YLEGLPSA | 0.9619 | 0.8626 | 10 | 18 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-A02:13 | YLEGLPSA | 0.9512 | 0.9089 | 10 | 18 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B39:13 | LEGLPSANL | 0.1946 | 0.9887 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B50:01 | LEGLPSANLA | 0.7238 | 0.7963 | 11 | 21 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B48:03 | LEGLPSANL | 0.979 | 0.5321 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B44:10 | LEGLPSANL | 0.7091 | 0.7705 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B39:08 | LEGLPSANL | 0.4045 | 0.9514 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B40:04 | LEGLPSANL | 0.9976 | 0.7907 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B40:12 | LEGLPSANL | 0.979 | 0.5321 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B41:03 | LEGLPSANL | 0.2571 | 0.6407 | 11 | 20 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B50:05 | LEGLPSANLA | 0.7238 | 0.7963 | 11 | 21 |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 | HLA-B50:04 | LEGLPSANLA | 0.7238 | 0.7963 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of ABL1-NTRK2 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ABL1-NTRK2 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 9054 | SSSCYLEGLPSANL | ABL1 | NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 460 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ABL1-NTRK2 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 9054 | SSSCYLEGLPSANL | -6.35143 | -7.38673 |
| HLA-B14:02 | 3BVN | 9054 | SSSCYLEGLPSANL | -5.20162 | -5.31502 |
| HLA-B52:01 | 3W39 | 9054 | SSSCYLEGLPSANL | -6.03049 | -6.14389 |
| HLA-B52:01 | 3W39 | 9054 | SSSCYLEGLPSANL | -5.12323 | -6.15853 |
| HLA-A24:02 | 5HGA | 9054 | SSSCYLEGLPSANL | -9.81198 | -9.92538 |
| HLA-A24:02 | 5HGA | 9054 | SSSCYLEGLPSANL | -7.16433 | -8.19963 |
| HLA-B44:05 | 3DX8 | 9054 | SSSCYLEGLPSANL | -6.46131 | -6.57471 |
| HLA-B44:05 | 3DX8 | 9054 | SSSCYLEGLPSANL | -3.08576 | -4.12106 |
| HLA-A02:01 | 6TDR | 9054 | SSSCYLEGLPSANL | -5.03933 | -5.15273 |
Top |
Vaccine Design for the FusionNeoAntigens of ABL1-NTRK2 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 10 | 18 | YLEGLPSA | ATCTGGAAGGTTTGCCATCTGCAA |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 11 | 20 | LEGLPSANL | TGGAAGGTTTGCCATCTGCAAATCTGG |
| ABL1-NTRK2 | chr9 | 133710912 | chr9 | 87338487 | 11 | 21 | LEGLPSANLA | TGGAAGGTTTGCCATCTGCAAATCTGGCCG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ABL1-NTRK2 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| ESCA | ABL1-NTRK2 | chr9 | 133710912 | ENST00000318560 | chr9 | 87338487 | ENST00000277120 | TCGA-VR-A8EW |
Top |
Potential target of CAR-T therapy development for ABL1-NTRK2 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000277120 | 5 | 19 | 431_454 | 0 | 839.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000304053 | 5 | 15 | 431_454 | 0 | 554.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000323115 | 4 | 17 | 431_454 | 0 | 823.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000359847 | 4 | 12 | 431_454 | 0 | 478.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000376208 | 5 | 14 | 431_454 | 0 | 538.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000376213 | 7 | 20 | 431_454 | 0 | 823.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000376214 | 7 | 21 | 431_454 | 0 | 839.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000395866 | 4 | 12 | 431_454 | 0 | 322.0 | Transmembrane | Helical | |
| Tgene | NTRK2 | chr9:133710912 | chr9:87338487 | ENST00000395882 | 5 | 13 | 431_454 | 0 | 478.0 | Transmembrane | Helical |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ABL1-NTRK2 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ABL1-NTRK2 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | ABL1 | C0023473 | Myeloid Leukemia, Chronic | 3 | CGI;CTD_human;ORPHANET |
| Hgene | ABL1 | C0023452 | Childhood Acute Lymphoblastic Leukemia | 2 | CTD_human |
| Hgene | ABL1 | C0023453 | L2 Acute Lymphoblastic Leukemia | 2 | CTD_human |
| Hgene | ABL1 | C1961102 | Precursor Cell Lymphoblastic Leukemia Lymphoma | 2 | CGI;CTD_human |
| Hgene | ABL1 | C0001418 | Adenocarcinoma | 1 | CTD_human |
| Hgene | ABL1 | C0003706 | Arachnodactyly | 1 | GENOMICS_ENGLAND |
| Hgene | ABL1 | C0005941 | Bone Diseases, Developmental | 1 | CTD_human |
| Hgene | ABL1 | C0006142 | Malignant neoplasm of breast | 1 | CTD_human |
| Hgene | ABL1 | C0006413 | Burkitt Lymphoma | 1 | ORPHANET |
| Hgene | ABL1 | C0014859 | Esophageal Neoplasms | 1 | CTD_human |
| Hgene | ABL1 | C0015544 | Failure to Thrive | 1 | CTD_human |
| Hgene | ABL1 | C0018798 | Congenital Heart Defects | 1 | CTD_human |
| Hgene | ABL1 | C0023903 | Liver neoplasms | 1 | CTD_human |
| Hgene | ABL1 | C0027659 | Neoplasms, Experimental | 1 | CTD_human |
| Hgene | ABL1 | C0032927 | Precancerous Conditions | 1 | CTD_human |
| Hgene | ABL1 | C0039075 | Syndactyly | 1 | GENOMICS_ENGLAND |
| Hgene | ABL1 | C0151491 | Congenital musculoskeletal anomalies | 1 | CTD_human |
| Hgene | ABL1 | C0205641 | Adenocarcinoma, Basal Cell | 1 | CTD_human |
| Hgene | ABL1 | C0205642 | Adenocarcinoma, Oxyphilic | 1 | CTD_human |
| Hgene | ABL1 | C0205643 | Carcinoma, Cribriform | 1 | CTD_human |
| Hgene | ABL1 | C0205644 | Carcinoma, Granular Cell | 1 | CTD_human |
| Hgene | ABL1 | C0205645 | Adenocarcinoma, Tubular | 1 | CTD_human |
| Hgene | ABL1 | C0265610 | Clinodactyly of fingers | 1 | GENOMICS_ENGLAND |
| Hgene | ABL1 | C0282313 | Condition, Preneoplastic | 1 | CTD_human |
| Hgene | ABL1 | C0345904 | Malignant neoplasm of liver | 1 | CTD_human |
| Hgene | ABL1 | C0546837 | Malignant neoplasm of esophagus | 1 | CTD_human |
| Hgene | ABL1 | C0596263 | Carcinogenesis | 1 | CTD_human |
| Hgene | ABL1 | C0678222 | Breast Carcinoma | 1 | CTD_human |
| Hgene | ABL1 | C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
| Hgene | ABL1 | C1292769 | Precursor B-cell lymphoblastic leukemia | 1 | ORPHANET |
| Hgene | ABL1 | C1458155 | Mammary Neoplasms | 1 | CTD_human |
| Hgene | ABL1 | C1961099 | Precursor T-Cell Lymphoblastic Leukemia-Lymphoma | 1 | CGI;ORPHANET |
| Hgene | ABL1 | C4539857 | CONGENITAL HEART DEFECTS AND SKELETAL MALFORMATIONS SYNDROME | 1 | GENOMICS_ENGLAND;UNIPROT |
| Hgene | ABL1 | C4551485 | Clinodactyly | 1 | GENOMICS_ENGLAND |
| Hgene | ABL1 | C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |
| Tgene | NTRK2 | C0011570 | Mental Depression | 5 | PSYGENET |
| Tgene | NTRK2 | C0011581 | Depressive disorder | 5 | PSYGENET |
| Tgene | NTRK2 | C0041696 | Unipolar Depression | 5 | PSYGENET |
| Tgene | NTRK2 | C0525045 | Mood Disorders | 5 | PSYGENET |
| Tgene | NTRK2 | C1269683 | Major Depressive Disorder | 5 | PSYGENET |
| Tgene | NTRK2 | C3151303 | Obesity, Hyperphagia, and Developmental Delay | 4 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| Tgene | NTRK2 | C0005586 | Bipolar Disorder | 3 | CTD_human;PSYGENET |
| Tgene | NTRK2 | C4693367 | EPILEPTIC ENCEPHALOPATHY, EARLY INFANTILE, 58 | 3 | GENOMICS_ENGLAND;UNIPROT |
| Tgene | NTRK2 | C0009171 | Cocaine Abuse | 2 | CTD_human |
| Tgene | NTRK2 | C0036341 | Schizophrenia | 2 | PSYGENET |
| Tgene | NTRK2 | C0038220 | Status Epilepticus | 2 | CTD_human |
| Tgene | NTRK2 | C0236736 | Cocaine-Related Disorders | 2 | CTD_human |
| Tgene | NTRK2 | C0270823 | Petit mal status | 2 | CTD_human |
| Tgene | NTRK2 | C0311335 | Grand Mal Status Epilepticus | 2 | CTD_human |
| Tgene | NTRK2 | C0393734 | Complex Partial Status Epilepticus | 2 | CTD_human |
| Tgene | NTRK2 | C0600427 | Cocaine Dependence | 2 | CTD_human |
| Tgene | NTRK2 | C0751217 | Hyperkinesia, Generalized | 2 | CTD_human |
| Tgene | NTRK2 | C0751522 | Status Epilepticus, Subclinical | 2 | CTD_human |
| Tgene | NTRK2 | C0751523 | Non-Convulsive Status Epilepticus | 2 | CTD_human |
| Tgene | NTRK2 | C0751524 | Simple Partial Status Epilepticus | 2 | CTD_human |
| Tgene | NTRK2 | C3887506 | Hyperkinesia | 2 | CTD_human |
| Tgene | NTRK2 | C0001973 | Alcoholic Intoxication, Chronic | 1 | PSYGENET |
| Tgene | NTRK2 | C0004114 | Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0004352 | Autistic Disorder | 1 | CTD_human |
| Tgene | NTRK2 | C0005587 | Depression, Bipolar | 1 | CTD_human |
| Tgene | NTRK2 | C0008073 | Developmental Disabilities | 1 | CTD_human |
| Tgene | NTRK2 | C0013415 | Dysthymic Disorder | 1 | PSYGENET |
| Tgene | NTRK2 | C0017638 | Glioma | 1 | CTD_human |
| Tgene | NTRK2 | C0020505 | Hyperphagia | 1 | CTD_human |
| Tgene | NTRK2 | C0024713 | Manic Disorder | 1 | CTD_human |
| Tgene | NTRK2 | C0027819 | Neuroblastoma | 1 | CTD_human |
| Tgene | NTRK2 | C0028754 | Obesity | 1 | CTD_human |
| Tgene | NTRK2 | C0036349 | Paranoid Schizophrenia | 1 | PSYGENET |
| Tgene | NTRK2 | C0037769 | West Syndrome | 1 | ORPHANET |
| Tgene | NTRK2 | C0085996 | Child Development Deviations | 1 | CTD_human |
| Tgene | NTRK2 | C0085997 | Child Development Disorders, Specific | 1 | CTD_human |
| Tgene | NTRK2 | C0205768 | Subependymal Giant Cell Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0259783 | mixed gliomas | 1 | CTD_human |
| Tgene | NTRK2 | C0280783 | Juvenile Pilocytic Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0280785 | Diffuse Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0334579 | Anaplastic astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0334580 | Protoplasmic astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0334581 | Gemistocytic astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0334582 | Fibrillary Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0334583 | Pilocytic Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0338070 | Childhood Cerebral Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0338831 | Manic | 1 | CTD_human |
| Tgene | NTRK2 | C0547065 | Mixed oligoastrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0555198 | Malignant Glioma | 1 | CTD_human |
| Tgene | NTRK2 | C0678807 | prenatal alcohol exposure | 1 | PSYGENET |
| Tgene | NTRK2 | C0750935 | Cerebral Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0750936 | Intracranial Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C0752347 | Lewy Body Disease | 1 | CTD_human |
| Tgene | NTRK2 | C1519086 | Pilomyxoid astrocytoma | 1 | ORPHANET |
| Tgene | NTRK2 | C1704230 | Grade I Astrocytoma | 1 | CTD_human |
| Tgene | NTRK2 | C3146244 | Alcohol Related Birth Defect | 1 | PSYGENET |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies