![]() |
|||||||
|
Fusion Protein:ANP32A-CPNE1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ANP32A-CPNE1 | FusionPDB ID: 4954 | FusionGDB2.0 ID: 4954 | Hgene | Tgene | Gene symbol | ANP32A | CPNE1 | Gene ID | 8125 | 8904 |
Gene name | acidic nuclear phosphoprotein 32 family member A | copine 1 | |
Synonyms | C15orf1|HPPCn|I1PP2A|LANP|MAPM|PHAP1|PHAPI|PP32 | COPN1|CPN1 | |
Cytomap | 15q23 | 20q11.22 | |
Type of gene | protein-coding | protein-coding | |
Description | acidic leucine-rich nuclear phosphoprotein 32 family member Aacidic (leucine-rich) nuclear phosphoprotein 32 family, member Aacidic nuclear phosphoprotein pp32cerebellar leucine rich acidic nuclear proteinepididymis secretory sperm binding proteinhep | copine-1chromobindin 17copine I | |
Modification date | 20200313 | 20200320 | |
UniProtAcc | P39687 Main function of 5'-partner protein: FUNCTION: Multifunctional protein that is involved in the regulation of many processes including tumor suppression, apoptosis, cell cycle progression or transcription (PubMed:16341127, PubMed:11360199, PubMed:18439902, PubMed:10400610). Promotes apoptosis by favouring the activation of caspase-9/CASP9 and allowing apoptosome formation (PubMed:18439902). In addition, plays a role in the modulation of histone acetylation and transcription as part of the INHAT (inhibitor of histone acetyltransferases) complex. Inhibits the histone-acetyltranferase activity of EP300/CREBBP (CREB-binding protein) and EP300/CREBBP-associated factor by histone masking (PubMed:11830591). Preferentially binds to unmodified histone H3 and sterically inhibiting its acetylation and phosphorylation leading to cell growth inhibition (PubMed:16341127). Participates in other biochemical processes such as regulation of mRNA nuclear-to-cytoplasmic translocation and stability by its association with ELAVL1 (Hu-antigen R) (PubMed:18180367). Plays a role in E4F1-mediated transcriptional repression as well as inhibition of protein phosphatase 2A (PubMed:15642345, PubMed:17557114). {ECO:0000269|PubMed:10400610, ECO:0000269|PubMed:11360199, ECO:0000269|PubMed:11830591, ECO:0000269|PubMed:15642345, ECO:0000269|PubMed:16341127, ECO:0000269|PubMed:17557114, ECO:0000269|PubMed:18180367, ECO:0000269|PubMed:18439902}.; FUNCTION: (Microbial infection) Plays an essential role in influenza A, B and C viral genome replication (PubMed:32694517, PubMed:33045004, PubMed:33208942, PubMed:30666459). Mechanistically, mediates the assembly of the viral replicase asymmetric dimers composed of PB1, PB2 and PA via its N-terminal region (PubMed:33208942). Plays also an essential role in foamy virus mRNA export from the nucleus (PubMed:21159877). {ECO:0000269|PubMed:21159877, ECO:0000269|PubMed:30666459, ECO:0000269|PubMed:32694517, ECO:0000269|PubMed:33045004, ECO:0000269|PubMed:33208942}. | Q99829 Main function of 5'-partner protein: FUNCTION: Calcium-dependent phospholipid-binding protein that plays a role in calcium-mediated intracellular processes (PubMed:14674885). Involved in the TNF-alpha receptor signaling pathway in a calcium-dependent manner (PubMed:14674885). Exhibits calcium-dependent phospholipid binding properties (PubMed:9430674, PubMed:19539605). Plays a role in neuronal progenitor cell differentiation; induces neurite outgrowth via a AKT-dependent signaling cascade and calcium-independent manner (PubMed:23263657, PubMed:25450385). May recruit target proteins to the cell membrane in a calcium-dependent manner (PubMed:12522145). May function in membrane trafficking (PubMed:9430674). Involved in TNF-alpha-induced NF-kappa-B transcriptional repression by inducing endoprotease processing of the transcription factor NF-kappa-B p65/RELA subunit (PubMed:18212740). Also induces endoprotease processing of NF-kappa-B p50/NFKB1, p52/NFKB2, RELB and REL (PubMed:18212740). {ECO:0000269|PubMed:12522145, ECO:0000269|PubMed:14674885, ECO:0000269|PubMed:18212740, ECO:0000269|PubMed:19539605, ECO:0000269|PubMed:23263657, ECO:0000269|PubMed:25450385, ECO:0000269|PubMed:9430674}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000465139, ENST00000560303, ENST00000483551, | ENST00000475146, ENST00000317619, ENST00000317677, ENST00000352393, ENST00000397442, ENST00000397443, ENST00000397445, ENST00000397446, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 6 X 4=192 | 17 X 7 X 8=952 |
# samples | 8 | 17 | |
** MAII score | log2(8/192*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(17/952*10)=-2.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ANP32A [Title/Abstract] AND CPNE1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ANP32A [Title/Abstract] AND CPNE1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ANP32A(69113036)-CPNE1(34220845), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ANP32A-CPNE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANP32A-CPNE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANP32A-CPNE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ANP32A-CPNE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ANP32A | GO:0006913 | nucleocytoplasmic transport | 11729309 |
Tgene | CPNE1 | GO:0043392 | negative regulation of DNA binding | 18212740 |
Tgene | CPNE1 | GO:0045666 | positive regulation of neuron differentiation | 23263657 |
Tgene | CPNE1 | GO:0051897 | positive regulation of protein kinase B signaling | 23263657 |
Tgene | CPNE1 | GO:1990138 | neuron projection extension | 23263657 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:69113036/chr20:34220845) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000352393 | CPNE1 | chr20 | 34220845 | - | 2022 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000317677 | CPNE1 | chr20 | 34220845 | - | 2009 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000397445 | CPNE1 | chr20 | 34220845 | - | 2007 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000317619 | CPNE1 | chr20 | 34220845 | - | 2007 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000397443 | CPNE1 | chr20 | 34220845 | - | 2007 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000397446 | CPNE1 | chr20 | 34220845 | - | 2007 | 198 | 93 | 1811 | 572 |
ENST00000465139 | ANP32A | chr15 | 69113036 | - | ENST00000397442 | CPNE1 | chr20 | 34220845 | - | 1819 | 198 | 93 | 1643 | 516 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000352393 | CPNE1 | chr20 | 34220845 | - | 2013 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000317677 | CPNE1 | chr20 | 34220845 | - | 2000 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000397445 | CPNE1 | chr20 | 34220845 | - | 1998 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000317619 | CPNE1 | chr20 | 34220845 | - | 1998 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000397443 | CPNE1 | chr20 | 34220845 | - | 1998 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000397446 | CPNE1 | chr20 | 34220845 | - | 1998 | 189 | 84 | 1802 | 572 |
ENST00000560303 | ANP32A | chr15 | 69113036 | - | ENST00000397442 | CPNE1 | chr20 | 34220845 | - | 1810 | 189 | 84 | 1634 | 516 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000465139 | ENST00000352393 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006334658 | 0.99366534 |
ENST00000465139 | ENST00000317677 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006115099 | 0.99388486 |
ENST00000465139 | ENST00000397445 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006102592 | 0.9938974 |
ENST00000465139 | ENST00000317619 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006102592 | 0.9938974 |
ENST00000465139 | ENST00000397443 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006102592 | 0.9938974 |
ENST00000465139 | ENST00000397446 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006102592 | 0.9938974 |
ENST00000465139 | ENST00000397442 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006834201 | 0.9931658 |
ENST00000560303 | ENST00000352393 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.00639505 | 0.99360496 |
ENST00000560303 | ENST00000317677 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006188159 | 0.99381185 |
ENST00000560303 | ENST00000397445 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006173247 | 0.9938267 |
ENST00000560303 | ENST00000317619 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006173247 | 0.9938267 |
ENST00000560303 | ENST00000397443 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006173247 | 0.9938267 |
ENST00000560303 | ENST00000397446 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006173247 | 0.9938267 |
ENST00000560303 | ENST00000397442 | ANP32A | chr15 | 69113036 | - | CPNE1 | chr20 | 34220845 | - | 0.006869195 | 0.99313074 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ANP32A-CPNE1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ANP32A | chr15 | 69113036 | CPNE1 | chr20 | 34220845 | 189 | 35 | RIHLELRNRTPSDMAHCVTLVQLSIS |
ANP32A | chr15 | 69113036 | CPNE1 | chr20 | 34220845 | 198 | 35 | RIHLELRNRTPSDMAHCVTLVQLSIS |
Top |
Potential FusionNeoAntigen Information of ANP32A-CPNE1 in HLA I |
![]() |
ANP32A-CPNE1_69113036_34220845.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:04 | TPSDMAHCV | 0.808 | 0.8368 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:02 | TPSDMAHCV | 0.808 | 0.8368 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:03 | TPSDMAHCV | 0.707 | 0.6738 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B08:01 | ELRNRTPSDM | 0.9658 | 0.6205 | 4 | 14 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:03 | TPSDMAHCVTL | 0.9903 | 0.5947 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:02 | TPSDMAHCVTL | 0.9719 | 0.7299 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:04 | TPSDMAHCVTL | 0.9719 | 0.7299 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:12 | TPSDMAHCV | 0.808 | 0.8368 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B39:08 | SDMAHCVTL | 0.7631 | 0.8392 | 11 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B42:02 | TPSDMAHCV | 0.2523 | 0.7176 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B39:10 | TPSDMAHCV | 0.2385 | 0.8545 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B42:01 | TPSDMAHCV | 0.2344 | 0.709 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B07:12 | TPSDMAHCVTL | 0.9983 | 0.526 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B42:02 | TPSDMAHCVTL | 0.9801 | 0.7167 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:12 | TPSDMAHCVTL | 0.9719 | 0.7299 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B42:01 | TPSDMAHCVTL | 0.9715 | 0.7111 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B39:10 | TPSDMAHCVTL | 0.9623 | 0.7942 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:09 | TPSDMAHCV | 0.808 | 0.8368 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B39:02 | SDMAHCVTL | 0.5901 | 0.9027 | 11 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B78:02 | TPSDMAHCV | 0.5812 | 0.5281 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B67:01 | TPSDMAHCV | 0.4616 | 0.7382 | 9 | 18 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B08:18 | ELRNRTPSDM | 0.9658 | 0.6205 | 4 | 14 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B35:09 | TPSDMAHCVTL | 0.9719 | 0.7299 | 9 | 20 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | HLA-B67:01 | TPSDMAHCVTL | 0.9696 | 0.6961 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of ANP32A-CPNE1 in HLA II |
![]() |
ANP32A-CPNE1_69113036_34220845.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1103 | RIHLELRNRTPSDMA | 0 | 15 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1155 | RIHLELRNRTPSDMA | 0 | 15 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1163 | RIHLELRNRTPSDMA | 0 | 15 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1176 | RIHLELRNRTPSDMA | 0 | 15 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1185 | RIHLELRNRTPSDMA | 0 | 15 |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 | DRB1-1324 | RIHLELRNRTPSDMA | 0 | 15 |
Top |
Fusion breakpoint peptide structures of ANP32A-CPNE1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8063 | RNRTPSDMAHCVTL | ANP32A | CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 198 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ANP32A-CPNE1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8063 | RNRTPSDMAHCVTL | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 8063 | RNRTPSDMAHCVTL | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 8063 | RNRTPSDMAHCVTL | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 8063 | RNRTPSDMAHCVTL | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 8063 | RNRTPSDMAHCVTL | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 8063 | RNRTPSDMAHCVTL | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 8063 | RNRTPSDMAHCVTL | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 8063 | RNRTPSDMAHCVTL | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 8063 | RNRTPSDMAHCVTL | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 8063 | RNRTPSDMAHCVTL | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 8063 | RNRTPSDMAHCVTL | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ANP32A-CPNE1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 11 | 20 | SDMAHCVTL | TCTGATATGGCCCACTGCGTGACCTTG |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 4 | 14 | ELRNRTPSDM | GAGCTGCGGAACAGGACGCCCTCTGATATG |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 9 | 18 | TPSDMAHCV | ACGCCCTCTGATATGGCCCACTGCGTG |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 9 | 20 | TPSDMAHCVTL | ACGCCCTCTGATATGGCCCACTGCGTGACCTTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ANP32A-CPNE1 | chr15 | 69113036 | chr20 | 34220845 | 0 | 15 | RIHLELRNRTPSDMA | CGGATTCATTTAGAGCTGCGGAACAGGACGCCCTCTGATATGGCC |
Top |
Information of the samples that have these potential fusion neoantigens of ANP32A-CPNE1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | ANP32A-CPNE1 | chr15 | 69113036 | ENST00000465139 | chr20 | 34220845 | ENST00000317619 | TCGA-BR-6453 |
Top |
Potential target of CAR-T therapy development for ANP32A-CPNE1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ANP32A-CPNE1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ANP32A-CPNE1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |