Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LRP8-RAD51C

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LRP8-RAD51C
	FusionPDB ID: 49838
	FusionGDB2.0 ID: 49838
		Hgene	Tgene
	Gene symbol	LRP8	RAD51C
	Gene ID	7804	5889
	Gene name	LDL receptor related protein 8	RAD51 paralog C
	Synonyms	APOER2\|HSZ75190\|LRP-8\|MCI1	BROVCA3\|FANCO\|R51H3\|RAD51L2
	Cytomap	1p32.3	17q22
	Type of gene	protein-coding	protein-coding
	Description	low-density lipoprotein receptor-related protein 8ApoE receptor 2low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	DNA repair protein RAD51 homolog 3RAD51-like protein 2yeast RAD51 homolog 3
	Modification date	20200313	20200313
	UniProtAcc	Q14114 Main function of 5'-partner protein: FUNCTION: Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation. May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (By similarity). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (By similarity). {ECO:0000250\|UniProtKB:Q924X6, ECO:0000269\|PubMed:12807892, ECO:0000269\|PubMed:12899622, ECO:0000269\|PubMed:12950167}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000306052, ENST00000347547, ENST00000354412, ENST00000371454, ENST00000465675, ENST00000460214,	ENST00000421782, ENST00000487921, ENST00000337432, ENST00000583539,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 12 X 6=576	12 X 11 X 4=528
	# samples	11	15
	** MAII score	log2(11/576*10)=-2.38856528791765 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/528*10)=-1.81557542886257 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LRP8 [Title/Abstract] AND RAD51C [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LRP8 [Title/Abstract] AND RAD51C [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LRP8(53720789)-RAD51C(56772292), # samples:3
Anticipated loss of major functional domain due to fusion event.	LRP8-RAD51C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-RAD51C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-RAD51C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-RAD51C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-RAD51C seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. LRP8-RAD51C seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	LRP8	GO:0006897	endocytosis	8626535
Tgene	RAD51C	GO:0006281	DNA repair	19451272
Tgene	RAD51C	GO:0006310	DNA recombination	19451272

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:53720789/chr17:56772292)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LRP8 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RAD51C (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000306052	LRP8	chr1	53720789	-	ENST00000583539	RAD51C	chr17	56772292	+	3708	2605	39	3500	1153
ENST00000306052	LRP8	chr1	53720789	-	ENST00000337432	RAD51C	chr17	56772292	+	3711	2605	39	3590	1183
ENST00000371454	LRP8	chr1	53720789	-	ENST00000583539	RAD51C	chr17	56772292	+	3748	2645	79	3540	1153
ENST00000371454	LRP8	chr1	53720789	-	ENST00000337432	RAD51C	chr17	56772292	+	3751	2645	79	3630	1183
ENST00000354412	LRP8	chr1	53720789	-	ENST00000583539	RAD51C	chr17	56772292	+	2994	1891	0	2786	928
ENST00000354412	LRP8	chr1	53720789	-	ENST00000337432	RAD51C	chr17	56772292	+	2997	1891	0	2876	958
ENST00000347547	LRP8	chr1	53720789	-	ENST00000583539	RAD51C	chr17	56772292	+	3096	1993	0	2888	962
ENST00000347547	LRP8	chr1	53720789	-	ENST00000337432	RAD51C	chr17	56772292	+	3099	1993	0	2978	992

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000306052	ENST00000583539	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.002104114	0.99789584
ENST00000306052	ENST00000337432	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.002367957	0.997632
ENST00000371454	ENST00000583539	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.002154159	0.9978459
ENST00000371454	ENST00000337432	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.002432903	0.9975672
ENST00000354412	ENST00000583539	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.001528378	0.99847156
ENST00000354412	ENST00000337432	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.001159542	0.9988405
ENST00000347547	ENST00000583539	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.001964751	0.99803525
ENST00000347547	ENST00000337432	LRP8	chr1	53720789	-	RAD51C	chr17	56772292	+	0.00150057	0.9984994

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LRP8-RAD51C

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LRP8	chr1	53720789	RAD51C	chr17	56772292	1891	630	TVTAAVIGIIVPIEVGISKAEALETL
LRP8	chr1	53720789	RAD51C	chr17	56772292	1993	664	TVTAAVIGIIVPIEVGISKAEALETL
LRP8	chr1	53720789	RAD51C	chr17	56772292	2605	855	TVTAAVIGIIVPIEVGISKAEALETL
LRP8	chr1	53720789	RAD51C	chr17	56772292	2645	855	TVTAAVIGIIVPIEVGISKAEALETL

Top

Potential FusionNeoAntigen Information of LRP8-RAD51C in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LRP8-RAD51C_53720789_56772292.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:01	IEVGISKA	0.969	0.5832	12	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A02:21	IIVPIEVGI	0.9414	0.6329	8	17
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B52:01	IGIIVPIEV	0.9199	0.9869	6	15
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A02:35	IIVPIEVGI	0.9037	0.5301	8	17
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:01	IEVGISKAEA	0.9616	0.7795	12	22
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A02:21	AVIGIIVPIEV	0.9902	0.8009	4	15
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B40:06	IEVGISKAEA	0.9843	0.5874	12	22
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:05	IEVGISKA	0.969	0.5832	12	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:04	IEVGISKA	0.969	0.5832	12	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A02:06	IIVPIEVGI	0.9414	0.6329	8	17
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A69:01	IIVPIEVGI	0.775	0.7502	8	17
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:05	IEVGISKAEA	0.9616	0.7795	12	22
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-B50:04	IEVGISKAEA	0.9616	0.7795	12	22
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	HLA-A02:06	AVIGIIVPIEV	0.9902	0.8009	4	15

Top

Potential FusionNeoAntigen Information of LRP8-RAD51C in HLA II

LRP8-RAD51C_53720789_56772292.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0403	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0413	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0415	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0415	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0427	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0427	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0436	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0436	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0439	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0440	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0441	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0442	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0442	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0444	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0446	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0449	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0450	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0451	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0452	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0453	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0453	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0455	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0456	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0458	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0458	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0459	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0459	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0460	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0465	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0468	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0470	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0471	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0478	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0478	VIGIIVPIEVGISKA	5	20
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0479	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0485	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0488	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0804	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0831	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0904	VPIEVGISKAEALET	10	25
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0906	VPIEVGISKAEALET	10	25
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0906	PIEVGISKAEALETL	11	26
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-0906	IVPIEVGISKAEALE	9	24
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-1002	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-1415	IGIIVPIEVGISKAE	6	21
LRP8-RAD51C	chr1	53720789	chr17	56772292	2605	DRB1-1452	IGIIVPIEVGISKAE	6	21

Top

Fusion breakpoint peptide structures of LRP8-RAD51C

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3694	IGIIVPIEVGISKA	LRP8	RAD51C	chr1	53720789	chr17	56772292	2605

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LRP8-RAD51C

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3694	IGIIVPIEVGISKA	-7.15543	-7.26883
HLA-B14:02	3BVN	3694	IGIIVPIEVGISKA	-4.77435	-5.80965
HLA-B52:01	3W39	3694	IGIIVPIEVGISKA	-6.80875	-6.92215
HLA-B52:01	3W39	3694	IGIIVPIEVGISKA	-4.20386	-5.23916
HLA-A11:01	4UQ2	3694	IGIIVPIEVGISKA	-7.5194	-8.5547
HLA-A11:01	4UQ2	3694	IGIIVPIEVGISKA	-6.9601	-7.0735
HLA-A24:02	5HGA	3694	IGIIVPIEVGISKA	-7.52403	-7.63743
HLA-A24:02	5HGA	3694	IGIIVPIEVGISKA	-5.82433	-6.85963
HLA-B27:05	6PYJ	3694	IGIIVPIEVGISKA	-3.28285	-4.31815
HLA-B44:05	3DX8	3694	IGIIVPIEVGISKA	-5.91172	-6.94702
HLA-B44:05	3DX8	3694	IGIIVPIEVGISKA	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of LRP8-RAD51C

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LRP8-RAD51C	chr1	53720789	chr17	56772292	12	20	IEVGISKA	TAGAAGTTGGGATATCTAAAGCAG
LRP8-RAD51C	chr1	53720789	chr17	56772292	12	22	IEVGISKAEA	TAGAAGTTGGGATATCTAAAGCAGAAGCCT
LRP8-RAD51C	chr1	53720789	chr17	56772292	4	15	AVIGIIVPIEV	CTGTTATCGGGATCATCGTGCCCATAGAAGTTG
LRP8-RAD51C	chr1	53720789	chr17	56772292	6	15	IGIIVPIEV	TCGGGATCATCGTGCCCATAGAAGTTG
LRP8-RAD51C	chr1	53720789	chr17	56772292	8	17	IIVPIEVGI	TCATCGTGCCCATAGAAGTTGGGATAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
LRP8-RAD51C	chr1	53720789	chr17	56772292	10	25	VPIEVGISKAEALET	TGCCCATAGAAGTTGGGATATCTAAAGCAGAAGCCTTAGAAACTC
LRP8-RAD51C	chr1	53720789	chr17	56772292	11	26	PIEVGISKAEALETL	CCATAGAAGTTGGGATATCTAAAGCAGAAGCCTTAGAAACTCTGC
LRP8-RAD51C	chr1	53720789	chr17	56772292	5	20	VIGIIVPIEVGISKA	TTATCGGGATCATCGTGCCCATAGAAGTTGGGATATCTAAAGCAG
LRP8-RAD51C	chr1	53720789	chr17	56772292	6	21	IGIIVPIEVGISKAE	TCGGGATCATCGTGCCCATAGAAGTTGGGATATCTAAAGCAGAAG
LRP8-RAD51C	chr1	53720789	chr17	56772292	9	24	IVPIEVGISKAEALE	TCGTGCCCATAGAAGTTGGGATATCTAAAGCAGAAGCCTTAGAAA

Top

Information of the samples that have these potential fusion neoantigens of LRP8-RAD51C

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	LRP8-RAD51C	chr1	53720789	ENST00000306052	chr17	56772292	ENST00000337432	TCGA-A8-A08F-01A

Top

Potential target of CAR-T therapy development for LRP8-RAD51C

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LRP8-RAD51C

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LRP8-RAD51C

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)