![]() |
|||||||
|
Fusion Protein:LYN-EXT1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: LYN-EXT1 | FusionPDB ID: 50441 | FusionGDB2.0 ID: 50441 | Hgene | Tgene | Gene symbol | LYN | EXT1 | Gene ID | 4067 | 2131 |
Gene name | LYN proto-oncogene, Src family tyrosine kinase | exostosin glycosyltransferase 1 | |
Synonyms | JTK8|p53Lyn|p56Lyn | EXT|LGCR|LGS|TRPS2|TTV | |
Cytomap | 8q12.1 | 8q24.11 | |
Type of gene | protein-coding | protein-coding | |
Description | tyrosine-protein kinase Lynlck/Yes-related novel protein tyrosine kinasev-yes-1 Yamaguchi sarcoma viral related oncogene homolog | exostosin-1Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferaseLanger-Giedion syndrome chromosome regionN-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferaseexostoses (multiple) 1glucuronosyl-N-acetylgluc | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | P0DP58 Main function of 5'-partner protein: FUNCTION: Acts in different tissues through interaction to nicotinic acetylcholine receptors (nAChRs) (PubMed:21252236). The proposed role as modulator of nAChR activity seems to be dependent on the nAChR subtype and stoichiometry, and to involve an effect on nAChR trafficking and its cell surface expression, and on single channel properties of the nAChR inserted in the plasma membrane. Modulates functional properties of nicotinic acetylcholine receptors (nAChRs) to prevent excessive excitation, and hence neurodegeneration. Enhances desensitization by increasing both the rate and extent of desensitization of alpha-4:beta-2-containing nAChRs and slowing recovery from desensitization. Promotes large amplitude ACh-evoked currents through alpha-4:beta-2 nAChRs. Is involved in regulation of the nAChR pentameric assembly in the endoplasmic reticulum. Shifts stoichiometry from high sensitivity alpha-4(2):beta-2(3) to low sensitivity alpha-4(3):beta-2(2) nAChR (By similarity). In vitro modulates alpha-3:beta-4-containing nAChRs. Reduces cell surface expression of (alpha-3:beta-4)(2):beta-4 and (alpha-3:beta-4)(2):alpha-5 nAChRs suggesting an interaction with nAChR alpha-3(-):(+)beta-4 subunit interfaces and an allosteric mode. Corresponding single channel effects characterized by decreased unitary conductance, altered burst proportions and enhanced desensitization/inactivation seem to depend on nAChR alpha:alpha subunit interfaces and are greater in (alpha-3:beta-2)(2):alpha-3 when compared to (alpha-3:beta-2)(2):alpha-5 nAChRs (PubMed:28100642). Prevents plasticity in the primary visual cortex late in life (By similarity). {ECO:0000250|UniProtKB:P0DP60, ECO:0000269|PubMed:21252236, ECO:0000269|PubMed:28100642}. | Q16394 Main function of 5'-partner protein: FUNCTION: Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Required for the exosomal release of SDCBP, CD63 and syndecan (PubMed:22660413). {ECO:0000269|PubMed:11518722, ECO:0000269|PubMed:22660413}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000519728, ENST00000420292, ENST00000520220, | ENST00000378204, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 11 X 7 X 7=539 | 15 X 10 X 7=1050 |
# samples | 13 | 17 | |
** MAII score | log2(13/539*10)=-2.05177364972405 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(17/1050*10)=-2.62678267641578 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: LYN [Title/Abstract] AND EXT1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: LYN [Title/Abstract] AND EXT1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | LYN(56854550)-EXT1(118842588), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | LYN-EXT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LYN-EXT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LYN-EXT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LYN-EXT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | LYN | GO:0006468 | protein phosphorylation | 11517336 |
Hgene | LYN | GO:0006974 | cellular response to DNA damage stimulus | 10891478|11517336 |
Hgene | LYN | GO:0018108 | peptidyl-tyrosine phosphorylation | 7682714|11782428 |
Hgene | LYN | GO:0046777 | protein autophosphorylation | 7682714 |
Hgene | LYN | GO:0051272 | positive regulation of cellular component movement | 16467205 |
Hgene | LYN | GO:0070304 | positive regulation of stress-activated protein kinase signaling cascade | 10891478 |
Tgene | EXT1 | GO:0006024 | glycosaminoglycan biosynthetic process | 12907669 |
Tgene | EXT1 | GO:0015012 | heparan sulfate proteoglycan biosynthetic process | 9620772|10639137 |
Tgene | EXT1 | GO:0033692 | cellular polysaccharide biosynthetic process | 12907669 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:56854550/chr8:118842588) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000519728 | LYN | chr8 | 56854550 | + | ENST00000378204 | EXT1 | chr8 | 118842588 | - | 6727 | 428 | 50 | 1504 | 484 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000519728 | ENST00000378204 | LYN | chr8 | 56854550 | + | EXT1 | chr8 | 118842588 | - | 0.000549417 | 0.9994506 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for LYN-EXT1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
LYN | chr8 | 56854550 | EXT1 | chr8 | 118842588 | 428 | 126 | YVRDPTSNKQQRPIPSTIRSIHQDKI |
Top |
Potential FusionNeoAntigen Information of LYN-EXT1 in HLA I |
![]() |
LYN-EXT1_56854550_118842588.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B52:01 | QRPIPSTI | 0.9898 | 0.9494 | 10 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B14:02 | QQRPIPSTI | 0.9958 | 0.8184 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B14:01 | QQRPIPSTI | 0.9958 | 0.8184 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:01 | QQRPIPSTI | 0.9927 | 0.9092 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B48:01 | QQRPIPSTI | 0.9867 | 0.6787 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B08:09 | QQRPIPSTI | 0.8645 | 0.7307 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A30:08 | QQRPIPSTI | 0.8162 | 0.7871 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B13:02 | QQRPIPSTI | 0.7935 | 0.7809 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B39:13 | QQRPIPSTI | 0.6908 | 0.9499 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B13:01 | QQRPIPSTI | 0.6569 | 0.9611 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:03 | QQRPIPSTI | 0.615 | 0.8079 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:37 | QQRPIPSTI | 0.4899 | 0.6066 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B52:01 | QQRPIPSTI | 0.4758 | 0.9641 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B13:02 | KQQRPIPST | 0.4594 | 0.7223 | 8 | 17 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A32:13 | QQRPIPSTI | 0.4569 | 0.9382 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:10 | QQRPIPSTI | 0.4448 | 0.6332 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B13:02 | KQQRPIPSTI | 0.6222 | 0.7134 | 8 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B13:01 | KQQRPIPSTI | 0.4131 | 0.9066 | 8 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B52:01 | KQQRPIPSTI | 0.1832 | 0.9601 | 8 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A74:11 | KQQRPIPSTIR | 0.9758 | 0.5688 | 8 | 19 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A74:03 | KQQRPIPSTIR | 0.9758 | 0.5688 | 8 | 19 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A74:09 | KQQRPIPSTIR | 0.9758 | 0.5688 | 8 | 19 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A31:02 | KQQRPIPSTIR | 0.9729 | 0.5625 | 8 | 19 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C06:03 | QQRPIPSTI | 0.9841 | 0.9939 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C12:12 | QQRPIPSTI | 0.9811 | 0.9714 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:07 | QQRPIPSTI | 0.9295 | 0.8035 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:04 | QQRPIPSTI | 0.9262 | 0.9345 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C02:06 | QQRPIPSTI | 0.8816 | 0.9555 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B14:03 | QQRPIPSTI | 0.8118 | 0.8612 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B39:08 | QQRPIPSTI | 0.7364 | 0.922 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B51:07 | QQRPIPSTI | 0.3996 | 0.8037 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B07:12 | RPIPSTIRSI | 0.9731 | 0.5044 | 11 | 21 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:04 | KQQRPIPSTI | 0.9095 | 0.8855 | 8 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B39:10 | RPIPSTIRSI | 0.6115 | 0.8754 | 11 | 21 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A31:01 | KQQRPIPSTIR | 0.9814 | 0.5032 | 8 | 19 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:24 | QQRPIPSTI | 0.9959 | 0.9103 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:135 | QQRPIPSTI | 0.9933 | 0.9101 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:27 | QQRPIPSTI | 0.9931 | 0.9175 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:34 | QQRPIPSTI | 0.9927 | 0.9092 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:33 | QQRPIPSTI | 0.9927 | 0.9092 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:125 | QQRPIPSTI | 0.9927 | 0.9092 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:73 | QQRPIPSTI | 0.9903 | 0.9587 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:50 | QQRPIPSTI | 0.9773 | 0.9377 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:30 | QQRPIPSTI | 0.9753 | 0.8865 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C06:17 | QQRPIPSTI | 0.9487 | 0.9925 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C06:02 | QQRPIPSTI | 0.9487 | 0.9925 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-C06:08 | QQRPIPSTI | 0.9482 | 0.989 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:68 | QQRPIPSTI | 0.937 | 0.7593 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:53 | QQRPIPSTI | 0.9029 | 0.892 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:35 | QQRPIPSTI | 0.8891 | 0.9088 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B39:02 | QQRPIPSTI | 0.8656 | 0.9513 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:54 | QQRPIPSTI | 0.8563 | 0.8807 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:12 | QQRPIPSTI | 0.8365 | 0.8869 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A30:01 | QQRPIPSTI | 0.8318 | 0.9004 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:13 | QQRPIPSTI | 0.6696 | 0.7097 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B40:21 | QQRPIPSTI | 0.574 | 0.5329 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B48:02 | QQRPIPSTI | 0.4838 | 0.9423 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:09 | QQRPIPSTI | 0.253 | 0.9022 | 9 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B15:73 | KQQRPIPSTI | 0.9445 | 0.9122 | 8 | 18 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B35:13 | RPIPSTIRSI | 0.6189 | 0.8783 | 11 | 21 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-B67:01 | RPIPSTIRSI | 0.5932 | 0.6354 | 11 | 21 |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 | HLA-A74:01 | KQQRPIPSTIR | 0.9758 | 0.5688 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of LYN-EXT1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of LYN-EXT1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8856 | SNKQQRPIPSTIRS | LYN | EXT1 | chr8 | 56854550 | chr8 | 118842588 | 428 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LYN-EXT1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8856 | SNKQQRPIPSTIRS | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 8856 | SNKQQRPIPSTIRS | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 8856 | SNKQQRPIPSTIRS | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 8856 | SNKQQRPIPSTIRS | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 8856 | SNKQQRPIPSTIRS | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 8856 | SNKQQRPIPSTIRS | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 8856 | SNKQQRPIPSTIRS | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 8856 | SNKQQRPIPSTIRS | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 8856 | SNKQQRPIPSTIRS | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 8856 | SNKQQRPIPSTIRS | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 8856 | SNKQQRPIPSTIRS | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of LYN-EXT1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 10 | 18 | QRPIPSTI | CAAAGGCCAATTCCTTCTACAATC |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 11 | 21 | RPIPSTIRSI | AGGCCAATTCCTTCTACAATCAGGTCTATT |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 8 | 17 | KQQRPIPST | AAACAGCAAAGGCCAATTCCTTCTACA |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 8 | 18 | KQQRPIPSTI | AAACAGCAAAGGCCAATTCCTTCTACAATC |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 8 | 19 | KQQRPIPSTIR | AAACAGCAAAGGCCAATTCCTTCTACAATCAGG |
LYN-EXT1 | chr8 | 56854550 | chr8 | 118842588 | 9 | 18 | QQRPIPSTI | CAGCAAAGGCCAATTCCTTCTACAATC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of LYN-EXT1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | LYN-EXT1 | chr8 | 56854550 | ENST00000519728 | chr8 | 118842588 | ENST00000378204 | TCGA-FP-8211-01A |
Top |
Potential target of CAR-T therapy development for LYN-EXT1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to LYN-EXT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to LYN-EXT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |