Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MAP4K1-SUMF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MAP4K1-SUMF2
	FusionPDB ID: 51385
	FusionGDB2.0 ID: 51385
		Hgene	Tgene
	Gene symbol	MAP4K1	SUMF2
	Gene ID	11184	25870
	Gene name	mitogen-activated protein kinase kinase kinase kinase 1	sulfatase modifying factor 2
	Synonyms	HPK1	pFGE
	Cytomap	19q13.2	7p11.2
	Type of gene	protein-coding	protein-coding
	Description	mitogen-activated protein kinase kinase kinase kinase 1MAPK/ERK kinase kinase kinase 1MEK kinase kinase 1MEKKK 1hematopoietic progenitor kinase 1	inactive C-alpha-formylglycine-generating enzyme 2C-alpha-formyglycine-generating enzyme 2C-alpha-formylglycine-generating enzyme 2epididymis secretory sperm binding proteinparalog of formylglycine-generating enzymeparalog of the formylglycine-genera
	Modification date	20200327	20200313
	UniProtAcc	Q92918 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase, which may play a role in the response to environmental stress (PubMed:24362026). Appears to act upstream of the JUN N-terminal pathway (PubMed:8824585). May play a role in hematopoietic lineage decisions and growth regulation (PubMed:8824585, PubMed:24362026). Able to autophosphorylate (PubMed:8824585). Together with CLNK, it enhances CD3-triggered activation of T-cells and subsequent IL2 production (By similarity). {ECO:0000250\|UniProtKB:P70218, ECO:0000269\|PubMed:24362026, ECO:0000269\|PubMed:8824585}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000396857, ENST00000586296, ENST00000589130, ENST00000591517, ENST00000423454, ENST00000589002,	ENST00000342190, ENST00000395435, ENST00000413756, ENST00000437307, ENST00000275607, ENST00000395436, ENST00000434526,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 2=8	5 X 6 X 3=90
	# samples	2	6
	** MAII score	log2(2/8*10)=1.32192809488736	log2(6/90*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MAP4K1 [Title/Abstract] AND SUMF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MAP4K1 [Title/Abstract] AND SUMF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MAP4K1(39106835)-SUMF2(56144527), # samples:1
Anticipated loss of major functional domain due to fusion event.	MAP4K1-SUMF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAP4K1-SUMF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MAP4K1	GO:0006468	protein phosphorylation	8824585
Hgene	MAP4K1	GO:0007257	activation of JUN kinase activity	8824585
Hgene	MAP4K1	GO:0018105	peptidyl-serine phosphorylation	11053428\|24362026
Hgene	MAP4K1	GO:0046777	protein autophosphorylation	8824585\|24362026
Hgene	MAP4K1	GO:1904628	cellular response to phorbol 13-acetate 12-myristate	8824585

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:39106835/chr7:56144527)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MAP4K1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SUMF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000591517	MAP4K1	chr19	39106835	-	ENST00000395436	SUMF2	chr7	56144527	+	1225	342	29	712	227
ENST00000591517	MAP4K1	chr19	39106835	-	ENST00000275607	SUMF2	chr7	56144527	+	1770	342	29	712	227
ENST00000591517	MAP4K1	chr19	39106835	-	ENST00000434526	SUMF2	chr7	56144527	+	1771	342	29	712	227
ENST00000586296	MAP4K1	chr19	39106835	-	ENST00000395436	SUMF2	chr7	56144527	+	1267	384	71	754	227
ENST00000586296	MAP4K1	chr19	39106835	-	ENST00000275607	SUMF2	chr7	56144527	+	1812	384	71	754	227
ENST00000586296	MAP4K1	chr19	39106835	-	ENST00000434526	SUMF2	chr7	56144527	+	1813	384	71	754	227
ENST00000589130	MAP4K1	chr19	39106835	-	ENST00000395436	SUMF2	chr7	56144527	+	1282	399	98	769	223
ENST00000589130	MAP4K1	chr19	39106835	-	ENST00000275607	SUMF2	chr7	56144527	+	1827	399	98	769	223
ENST00000589130	MAP4K1	chr19	39106835	-	ENST00000434526	SUMF2	chr7	56144527	+	1828	399	98	769	223
ENST00000396857	MAP4K1	chr19	39106835	-	ENST00000395436	SUMF2	chr7	56144527	+	1304	421	108	791	227
ENST00000396857	MAP4K1	chr19	39106835	-	ENST00000275607	SUMF2	chr7	56144527	+	1849	421	108	791	227
ENST00000396857	MAP4K1	chr19	39106835	-	ENST00000434526	SUMF2	chr7	56144527	+	1850	421	108	791	227

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000591517	ENST00000395436	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003579391	0.9964206
ENST00000591517	ENST00000275607	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003816256	0.9961837
ENST00000591517	ENST00000434526	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003829499	0.99617046
ENST00000586296	ENST00000395436	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.004180574	0.99581945
ENST00000586296	ENST00000275607	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.004543389	0.9954566
ENST00000586296	ENST00000434526	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.0045626	0.99543744
ENST00000589130	ENST00000395436	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003171115	0.99682885
ENST00000589130	ENST00000275607	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003656553	0.99634343
ENST00000589130	ENST00000434526	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.003672841	0.9963271
ENST00000396857	ENST00000395436	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.004584545	0.99541545
ENST00000396857	ENST00000275607	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.004490032	0.99551
ENST00000396857	ENST00000434526	MAP4K1	chr19	39106835	-	SUMF2	chr7	56144527	+	0.004468516	0.9955315

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MAP4K1-SUMF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MAP4K1	chr19	39106835	SUMF2	chr7	56144527	342	104	EFCGAGSLQDIYQGQVYPWGNWFQPN
MAP4K1	chr19	39106835	SUMF2	chr7	56144527	384	104	EFCGAGSLQDIYQGQVYPWGNWFQPN
MAP4K1	chr19	39106835	SUMF2	chr7	56144527	399	100	EFCGAGSLQDIYQGQVYPWGNWFQPN
MAP4K1	chr19	39106835	SUMF2	chr7	56144527	421	104	EFCGAGSLQDIYQGQVYPWGNWFQPN

Top

Potential FusionNeoAntigen Information of MAP4K1-SUMF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MAP4K1-SUMF2_39106835_56144527.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:02	DIYQGQVY	0.9848	0.9119	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:25	IYQGQVYPW	0.998	0.6429	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:20	IYQGQVYPW	0.9978	0.6401	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:15	IYQGQVYPW	0.9975	0.6472	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:31	IYQGQVYPW	0.9974	0.5962	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:17	IYQGQVYPW	0.9922	0.6917	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A31:08	IYQGQVYPW	0.9631	0.5842	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:01	QDIYQGQVY	0.5222	0.9105	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:01	LQDIYQGQVY	0.9982	0.8856	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:22	SLQDIYQGQV	0.9964	0.8679	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:27	SLQDIYQGQV	0.9928	0.8655	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:13	SLQDIYQGQV	0.9922	0.907	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:38	SLQDIYQGQV	0.99	0.8793	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:67	SLQDIYQGQV	0.9844	0.8678	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:30	SLQDIYQGQV	0.9844	0.8678	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:24	SLQDIYQGQV	0.9844	0.8678	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:60	SLQDIYQGQV	0.9842	0.8832	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:16	SLQDIYQGQV	0.9838	0.7888	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:11	SLQDIYQGQV	0.9822	0.8813	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:19	SLQDIYQGQV	0.9594	0.8163	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:35	SLQDIYQGQV	0.9508	0.8923	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:04	SLQDIYQGQV	0.9503	0.9417	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:25	LQDIYQGQVY	0.9183	0.9185	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:29	SLQDIYQGQV	0.8929	0.8709	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:20	SLQDIYQGQV	0.8703	0.8742	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:02	LQDIYQGQVY	0.8241	0.9249	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:03	LQDIYQGQVY	0.7553	0.7499	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:01	SLQDIYQGQVY	0.9998	0.9322	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:25	SLQDIYQGQVY	0.9924	0.9418	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:02	SLQDIYQGQVY	0.985	0.9427	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A24:02	IYQGQVYPW	0.9978	0.6401	10	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:02	SLQDIYQGQV	0.9965	0.8225	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:07	LQDIYQGQVY	0.9885	0.6313	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:01	SLQDIYQGQV	0.9844	0.8678	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:05	LQDIYQGQVY	0.9239	0.8899	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:04	LQDIYQGQVY	0.8847	0.88	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:31	LQDIYQGQVY	0.821	0.9	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:07	SLQDIYQGQVY	0.9977	0.6873	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:05	SLQDIYQGQVY	0.9831	0.9005	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:31	SLQDIYQGQVY	0.9667	0.9054	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:11	DIYQGQVY	0.978	0.8739	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:24	DIYQGQVY	0.9577	0.8707	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:11	DIYQGQVY	0.9568	0.8462	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:08	DIYQGQVY	0.9544	0.8353	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:43	DIYQGQVY	0.9386	0.8343	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:04	DIYQGQVY	0.9218	0.9113	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:07	DIYQGQVY	0.8668	0.8551	9	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:20	QDIYQGQVY	0.7577	0.9512	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:04	QDIYQGQVY	0.7522	0.9185	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:11	QDIYQGQVY	0.6877	0.9109	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:05	QDIYQGQVY	0.5222	0.9105	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:08	QDIYQGQVY	0.5128	0.8682	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B18:06	QDIYQGQVY	0.4996	0.9153	8	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:34	LQDIYQGQVY	0.9982	0.8856	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:33	LQDIYQGQVY	0.9982	0.8856	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:125	LQDIYQGQVY	0.9982	0.8856	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:27	LQDIYQGQVY	0.998	0.8927	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:135	LQDIYQGQVY	0.9977	0.8948	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:50	LQDIYQGQVY	0.9973	0.9284	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A02:03	SLQDIYQGQV	0.9965	0.929	6	16
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-A25:01	DIYQGQVYPW	0.9878	0.9673	9	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:35	LQDIYQGQVY	0.985	0.8689	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:53	LQDIYQGQVY	0.9842	0.866	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:12	LQDIYQGQVY	0.9805	0.8968	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:54	LQDIYQGQVY	0.9724	0.8413	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:20	LQDIYQGQVY	0.926	0.9262	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:39	LQDIYQGQVY	0.9201	0.8219	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:28	LQDIYQGQVY	0.9127	0.9262	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:13	DIYQGQVYPW	0.9104	0.87	9	19
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B48:02	LQDIYQGQVY	0.8019	0.9112	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:20	LQDIYQGQVY	0.7928	0.9326	7	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:27	SLQDIYQGQVY	0.9998	0.9481	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:34	SLQDIYQGQVY	0.9998	0.9322	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:33	SLQDIYQGQVY	0.9998	0.9322	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:135	SLQDIYQGQVY	0.9998	0.9295	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:50	SLQDIYQGQVY	0.9998	0.9524	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:125	SLQDIYQGQVY	0.9998	0.9322	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:12	SLQDIYQGQVY	0.9997	0.8972	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:35	SLQDIYQGQVY	0.9973	0.9124	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:39	SLQDIYQGQVY	0.9925	0.9009	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B15:20	SLQDIYQGQVY	0.984	0.9318	6	17
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	421	HLA-B35:28	SLQDIYQGQVY	0.9756	0.928	6	17

Top

Potential FusionNeoAntigen Information of MAP4K1-SUMF2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MAP4K1-SUMF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8776	SLQDIYQGQVYPWG	MAP4K1	SUMF2	chr19	39106835	chr7	56144527	421

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MAP4K1-SUMF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8776	SLQDIYQGQVYPWG	-7.59806	-7.59806
HLA-A11:01	4UQ2	8776	SLQDIYQGQVYPWG	-5.94152	-5.94152
HLA-A24:02	5HGA	8776	SLQDIYQGQVYPWG	-7.03876	-7.03876

Top

Vaccine Design for the FusionNeoAntigens of MAP4K1-SUMF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	10	19	IYQGQVYPW	TCTACCAAGGTCAAGTTTACCCATGGG
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	6	16	SLQDIYQGQV	CTCTCCAGGACATCTACCAAGGTCAAGTTT
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	6	17	SLQDIYQGQVY	CTCTCCAGGACATCTACCAAGGTCAAGTTTACC
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	7	17	LQDIYQGQVY	TCCAGGACATCTACCAAGGTCAAGTTTACC
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	8	17	QDIYQGQVY	AGGACATCTACCAAGGTCAAGTTTACC
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	9	17	DIYQGQVY	ACATCTACCAAGGTCAAGTTTACC
MAP4K1-SUMF2	chr19	39106835	chr7	56144527	9	19	DIYQGQVYPW	ACATCTACCAAGGTCAAGTTTACCCATGGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MAP4K1-SUMF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	MAP4K1-SUMF2	chr19	39106835	ENST00000396857	chr7	56144527	ENST00000275607	TCGA-CG-5721-01A

Top

Potential target of CAR-T therapy development for MAP4K1-SUMF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MAP4K1-SUMF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MAP4K1-SUMF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)