Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:AP1B1-ADRBK2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: AP1B1-ADRBK2
	FusionPDB ID: 5161
	FusionGDB2.0 ID: 5165
		Hgene	Tgene
	Gene symbol	AP1B1	ADRBK2
	Gene ID	162	157
	Gene name	adaptor related protein complex 1 subunit beta 1	G protein-coupled receptor kinase 3
	Synonyms	ADTB1\|AP105A\|BAM22\|CLAPB2\|KIDAR	ADRBK2\|BARK2
	Cytomap	22q12.2	22q12.1
	Type of gene	protein-coding	protein-coding
	Description	AP-1 complex subunit beta-1ADTB1, CLAPB2Golgi adaptor HA1/AP1 adaptin beta subunitadapter-related protein complex 1 subunit beta-1adaptor protein complex AP-1 subunit beta-1adaptor related protein complex 1 beta 1 subunitbeta-1-adaptinbeta-adaptin	beta-adrenergic receptor kinase 2adrenergic, beta, receptor kinase 2beta-ARK-2
	Modification date	20200313	20200313
	UniProtAcc	Q10567 Main function of 5'-partner protein: FUNCTION: Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes (PubMed:31630791). The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules. {ECO:0000269\|PubMed:31630791}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000317368, ENST00000356015, ENST00000357586, ENST00000402502, ENST00000405198, ENST00000415447, ENST00000432560, ENST00000472057,	ENST00000324198,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 11 X 7=847	3 X 2 X 3=18
	# samples	13	3
	** MAII score	log2(13/847*10)=-2.70385034630374 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: AP1B1 [Title/Abstract] AND ADRBK2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: AP1B1 [Title/Abstract] AND ADRBK2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ADRBK2(26086250)-AP1B1(29747814), # samples:2 AP1B1(29750639)-ADRBK2(26091074), # samples:2
Anticipated loss of major functional domain due to fusion event.	ADRBK2-AP1B1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADRBK2-AP1B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AP1B1-ADRBK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AP1B1-ADRBK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AP1B1-ADRBK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AP1B1-ADRBK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ADRBK2	GO:0031623	receptor internalization	20074556

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr22:26086250/chr22:29747814)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across AP1B1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ADRBK2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000356015	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8984	1125	187	2139	650
ENST00000432560	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8984	1125	187	2139	650
ENST00000357586	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8984	1125	187	2139	650
ENST00000405198	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8829	970	32	1984	650
ENST00000317368	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8984	1125	187	2139	650
ENST00000402502	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8829	970	32	1984	650
ENST00000415447	AP1B1	chr22	29750639	-	ENST00000324198	ADRBK2	chr22	26091074	+	8815	956	18	1970	650

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000356015	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000129476	0.99987054
ENST00000432560	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000129476	0.99987054
ENST00000357586	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000129476	0.99987054
ENST00000405198	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000124203	0.9998758
ENST00000317368	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000129476	0.99987054
ENST00000402502	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000124203	0.9998758
ENST00000415447	ENST00000324198	AP1B1	chr22	29750639	-	ADRBK2	chr22	26091074	+	0.000122286	0.9998777

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for AP1B1-ADRBK2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
AP1B1	chr22	29750639	ADRBK2	chr22	26091074	1125	312	YVALRNINLIVQKSGTHGYMAPEVLQ
AP1B1	chr22	29750639	ADRBK2	chr22	26091074	956	312	YVALRNINLIVQKSGTHGYMAPEVLQ
AP1B1	chr22	29750639	ADRBK2	chr22	26091074	970	312	YVALRNINLIVQKSGTHGYMAPEVLQ

Top

Potential FusionNeoAntigen Information of AP1B1-ADRBK2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

AP1B1-ADRBK2_29750639_26091074.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:01	VQKSGTHGY	0.9998	0.7798	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:25	VQKSGTHGY	0.9753	0.8271	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:02	VQKSGTHGY	0.9383	0.8515	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:03	VQKSGTHGY	0.4938	0.6782	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:18	VQKSGTHGY	0.3703	0.6369	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:01	IVQKSGTHGY	0.9996	0.7823	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:01	VQKSGTHGYM	0.998	0.7721	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:25	IVQKSGTHGY	0.9954	0.8326	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:02	IVQKSGTHGY	0.9851	0.8406	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:03	IVQKSGTHGY	0.7962	0.5486	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:01	LIVQKSGTHGY	0.9999	0.6853	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:25	LIVQKSGTHGY	0.9986	0.7941	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:07	VQKSGTHGY	0.9961	0.5856	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:04	VQKSGTHGY	0.9624	0.8294	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:21	VQKSGTHGY	0.9413	0.8125	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:05	VQKSGTHGY	0.6566	0.8559	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-C12:16	VQKSGTHGY	0.5776	0.9338	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:31	VQKSGTHGY	0.5524	0.8662	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:07	IVQKSGTHGY	0.9991	0.5214	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:04	IVQKSGTHGY	0.9933	0.7973	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:04	VQKSGTHGYM	0.9924	0.8546	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:07	VQKSGTHGYM	0.9924	0.682	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:05	IVQKSGTHGY	0.9202	0.7027	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:04	LIVQKSGTHGY	0.9984	0.709	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:135	VQKSGTHGY	0.9998	0.7803	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:34	VQKSGTHGY	0.9998	0.7798	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:27	VQKSGTHGY	0.9998	0.8136	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:125	VQKSGTHGY	0.9998	0.7798	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:33	VQKSGTHGY	0.9998	0.7798	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:50	VQKSGTHGY	0.9996	0.8613	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:11	VQKSGTHGY	0.9994	0.7246	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:24	VQKSGTHGY	0.9989	0.7865	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:35	VQKSGTHGY	0.9956	0.7876	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:12	VQKSGTHGY	0.9946	0.8462	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:53	VQKSGTHGY	0.9858	0.7638	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:39	VQKSGTHGY	0.9775	0.7414	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:54	VQKSGTHGY	0.8488	0.7211	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:13	VQKSGTHGY	0.6511	0.7311	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:20	VQKSGTHGY	0.6506	0.9017	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:73	VQKSGTHGY	0.5871	0.7855	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:68	VQKSGTHGY	0.5858	0.5038	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B35:28	VQKSGTHGY	0.5714	0.9135	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B18:04	VQKSGTHGY	0.5601	0.8862	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B35:20	VQKSGTHGY	0.5115	0.9176	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B18:11	VQKSGTHGY	0.5028	0.8817	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-C12:02	VQKSGTHGY	0.4419	0.9484	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:30	VQKSGTHGY	0.4299	0.8673	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B18:06	VQKSGTHGY	0.278	0.8836	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B48:02	VQKSGTHGY	0.1408	0.8911	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-C02:02	VQKSGTHGY	0.1125	0.9613	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-C02:10	VQKSGTHGY	0.1125	0.9613	10	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:27	IVQKSGTHGY	0.9996	0.8469	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:34	IVQKSGTHGY	0.9996	0.7823	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:125	IVQKSGTHGY	0.9996	0.7823	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:33	IVQKSGTHGY	0.9996	0.7823	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:135	IVQKSGTHGY	0.9996	0.7891	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:35	IVQKSGTHGY	0.9991	0.7793	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:50	IVQKSGTHGY	0.999	0.9152	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:24	IVQKSGTHGY	0.9988	0.8647	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:34	VQKSGTHGYM	0.998	0.7721	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:125	VQKSGTHGYM	0.998	0.7721	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:33	VQKSGTHGYM	0.998	0.7721	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:135	VQKSGTHGYM	0.998	0.7801	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:27	VQKSGTHGYM	0.9979	0.8526	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:12	IVQKSGTHGY	0.9977	0.8705	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:53	IVQKSGTHGY	0.9967	0.7589	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:54	VQKSGTHGYM	0.9964	0.7254	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:39	IVQKSGTHGY	0.9949	0.6901	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:53	VQKSGTHGYM	0.9944	0.7549	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:68	VQKSGTHGYM	0.9937	0.5917	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:50	VQKSGTHGYM	0.9933	0.8543	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:35	VQKSGTHGYM	0.9903	0.8494	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:54	IVQKSGTHGY	0.9896	0.7042	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:73	VQKSGTHGYM	0.9759	0.9083	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:30	VQKSGTHGYM	0.9449	0.898	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:20	IVQKSGTHGY	0.9295	0.7877	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:12	VQKSGTHGYM	0.9258	0.8047	10	20
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B35:28	IVQKSGTHGY	0.8974	0.7994	9	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:33	LIVQKSGTHGY	0.9999	0.6853	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:125	LIVQKSGTHGY	0.9999	0.6853	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:135	LIVQKSGTHGY	0.9999	0.7149	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:27	LIVQKSGTHGY	0.9999	0.7954	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:34	LIVQKSGTHGY	0.9999	0.6853	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:50	LIVQKSGTHGY	0.9998	0.8168	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:35	LIVQKSGTHGY	0.9997	0.6807	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:12	LIVQKSGTHGY	0.9995	0.8281	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:53	LIVQKSGTHGY	0.9988	0.6574	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:39	LIVQKSGTHGY	0.9985	0.6183	8	19
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	1125	HLA-B15:54	LIVQKSGTHGY	0.993	0.593	8	19

Top

Potential FusionNeoAntigen Information of AP1B1-ADRBK2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of AP1B1-ADRBK2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3859	INLIVQKSGTHGYM	AP1B1	ADRBK2	chr22	29750639	chr22	26091074	1125

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AP1B1-ADRBK2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3859	INLIVQKSGTHGYM	-6.85977	-6.97287
HLA-B14:02	3BVN	3859	INLIVQKSGTHGYM	-4.6725	-5.7168
HLA-B52:01	3W39	3859	INLIVQKSGTHGYM	-7.30149	-7.41459
HLA-B52:01	3W39	3859	INLIVQKSGTHGYM	-5.83473	-6.87903
HLA-A24:02	5HGA	3859	INLIVQKSGTHGYM	-8.97027	-9.08337
HLA-A24:02	5HGA	3859	INLIVQKSGTHGYM	-4.63724	-5.68154
HLA-B44:05	3DX8	3859	INLIVQKSGTHGYM	-7.36679	-7.47989
HLA-B44:05	3DX8	3859	INLIVQKSGTHGYM	-6.02058	-7.06488

Top

Vaccine Design for the FusionNeoAntigens of AP1B1-ADRBK2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	10	19	VQKSGTHGY	GCAGAAAAGTGGCACCCATGGGTACAT
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	10	20	VQKSGTHGYM	GCAGAAAAGTGGCACCCATGGGTACATGGC
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	8	19	LIVQKSGTHGY	CATCGTGCAGAAAAGTGGCACCCATGGGTACAT
AP1B1-ADRBK2	chr22	29750639	chr22	26091074	9	19	IVQKSGTHGY	CGTGCAGAAAAGTGGCACCCATGGGTACAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of AP1B1-ADRBK2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	AP1B1-ADRBK2	chr22	29750639	ENST00000317368	chr22	26091074	ENST00000324198	TCGA-C4-A0F7-01A

Top

Potential target of CAR-T therapy development for AP1B1-ADRBK2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to AP1B1-ADRBK2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to AP1B1-ADRBK2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)