![]() |
|||||||
|
Fusion Protein:MAPKAPK5-CCDC38 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MAPKAPK5-CCDC38 | FusionPDB ID: 51622 | FusionGDB2.0 ID: 51622 | Hgene | Tgene | Gene symbol | MAPKAPK5 | CCDC38 | Gene ID | 8550 | 120935 |
Gene name | MAPK activated protein kinase 5 | coiled-coil domain containing 38 | |
Synonyms | MAPKAP-K5|MK-5|MK5|PRAK | - | |
Cytomap | 12q24.12-q24.13 | 12q23.1 | |
Type of gene | protein-coding | protein-coding | |
Description | MAP kinase-activated protein kinase 5MAPKAP kinase 5MAPKAPK-5mitogen-activated protein kinase-activated protein kinase 5p38-regulated/activated protein kinase | coiled-coil domain-containing protein 38 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q8IW41 Main function of 5'-partner protein: FUNCTION: Tumor suppressor serine/threonine-protein kinase involved in mTORC1 signaling and post-transcriptional regulation. Phosphorylates FOXO3, ERK3/MAPK6, ERK4/MAPK4, HSP27/HSPB1, p53/TP53 and RHEB. Acts as a tumor suppressor by mediating Ras-induced senescence and phosphorylating p53/TP53. Involved in post-transcriptional regulation of MYC by mediating phosphorylation of FOXO3: phosphorylation of FOXO3 leads to promote nuclear localization of FOXO3, enabling expression of miR-34b and miR-34c, 2 post-transcriptional regulators of MYC that bind to the 3'UTR of MYC transcript and prevent MYC translation. Acts as a negative regulator of mTORC1 signaling by mediating phosphorylation and inhibition of RHEB. Part of the atypical MAPK signaling via its interaction with ERK3/MAPK6 or ERK4/MAPK4: the precise role of the complex formed with ERK3/MAPK6 or ERK4/MAPK4 is still unclear, but the complex follows a complex set of phosphorylation events: upon interaction with atypical MAPK (ERK3/MAPK6 or ERK4/MAPK4), ERK3/MAPK6 (or ERK4/MAPK4) is phosphorylated and then mediates phosphorylation and activation of MAPKAPK5, which in turn phosphorylates ERK3/MAPK6 (or ERK4/MAPK4). Mediates phosphorylation of HSP27/HSPB1 in response to PKA/PRKACA stimulation, inducing F-actin rearrangement. {ECO:0000269|PubMed:17254968, ECO:0000269|PubMed:17728103, ECO:0000269|PubMed:19166925, ECO:0000269|PubMed:21329882, ECO:0000269|PubMed:9628874}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000546394, ENST00000547305, ENST00000550735, ENST00000551404, | ENST00000344280, ENST00000546386, ENST00000549752, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 12 X 10=1560 | 2 X 2 X 2=8 |
# samples | 20 | 2 | |
** MAII score | log2(20/1560*10)=-2.96347412397489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(2/8*10)=1.32192809488736 | |
Fusion gene context | PubMed: MAPKAPK5 [Title/Abstract] AND CCDC38 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MAPKAPK5 [Title/Abstract] AND CCDC38 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MAPKAPK5(112280573)-CCDC38(96266238), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | MAPKAPK5-CCDC38 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAPKAPK5-CCDC38 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MAPKAPK5 | GO:0006417 | regulation of translation | 21329882 |
Hgene | MAPKAPK5 | GO:0007265 | Ras protein signal transduction | 17254968 |
Hgene | MAPKAPK5 | GO:0046777 | protein autophosphorylation | 21329882 |
Hgene | MAPKAPK5 | GO:0090400 | stress-induced premature senescence | 17254968 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:112280573/chr12:96266238) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000550735 | MAPKAPK5 | chr12 | 112280573 | + | ENST00000344280 | CCDC38 | chr12 | 96266238 | - | 1233 | 792 | 375 | 1205 | 276 |
ENST00000551404 | MAPKAPK5 | chr12 | 112280573 | + | ENST00000344280 | CCDC38 | chr12 | 96266238 | - | 585 | 144 | 33 | 557 | 174 |
ENST00000547305 | MAPKAPK5 | chr12 | 112280573 | + | ENST00000344280 | CCDC38 | chr12 | 96266238 | - | 736 | 295 | 28 | 708 | 226 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000550735 | ENST00000344280 | MAPKAPK5 | chr12 | 112280573 | + | CCDC38 | chr12 | 96266238 | - | 0.005381093 | 0.9946189 |
ENST00000551404 | ENST00000344280 | MAPKAPK5 | chr12 | 112280573 | + | CCDC38 | chr12 | 96266238 | - | 0.004186717 | 0.9958133 |
ENST00000547305 | ENST00000344280 | MAPKAPK5 | chr12 | 112280573 | + | CCDC38 | chr12 | 96266238 | - | 0.002558934 | 0.99744105 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MAPKAPK5-CCDC38 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MAPKAPK5 | chr12 | 112280573 | CCDC38 | chr12 | 96266238 | 144 | 37 | SMSEESDMDKAIKEILIDSLSKKITQ |
MAPKAPK5 | chr12 | 112280573 | CCDC38 | chr12 | 96266238 | 295 | 89 | SMSEESDMDKAIKEILIDSLSKKITQ |
MAPKAPK5 | chr12 | 112280573 | CCDC38 | chr12 | 96266238 | 792 | 139 | SMSEESDMDKAIKEILIDSLSKKITQ |
Top |
Potential FusionNeoAntigen Information of MAPKAPK5-CCDC38 in HLA I |
![]() |
MAPKAPK5-CCDC38_112280573_96266238.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | HLA-B39:13 | KEILIDSL | 0.9611 | 0.72 | 12 | 20 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | HLA-B39:08 | KEILIDSL | 0.9921 | 0.6376 | 12 | 20 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | HLA-B51:07 | DMDKAIKEI | 0.9558 | 0.7485 | 6 | 15 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | HLA-B40:04 | KEILIDSL | 0.9997 | 0.527 | 12 | 20 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | HLA-B39:02 | KEILIDSL | 0.9602 | 0.7289 | 12 | 20 |
Top |
Potential FusionNeoAntigen Information of MAPKAPK5-CCDC38 in HLA II |
![]() |
MAPKAPK5-CCDC38_112280573_96266238.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB1-0303 | IKEILIDSLSKKITQ | 11 | 26 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0101 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0101 | MDKAIKEILIDSLSK | 7 | 22 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0103 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0103 | MDKAIKEILIDSLSK | 7 | 22 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0104 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0104 | MDKAIKEILIDSLSK | 7 | 22 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0106 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0106 | MDKAIKEILIDSLSK | 7 | 22 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0107 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0107 | MDKAIKEILIDSLSK | 7 | 22 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0108 | DKAIKEILIDSLSKK | 8 | 23 |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 | DRB4-0108 | MDKAIKEILIDSLSK | 7 | 22 |
Top |
Fusion breakpoint peptide structures of MAPKAPK5-CCDC38 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1251 | DMDKAIKEILIDSL | MAPKAPK5 | CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 295 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MAPKAPK5-CCDC38 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1251 | DMDKAIKEILIDSL | -6.12283 | -6.12283 |
HLA-A24:02 | 5HGA | 1251 | DMDKAIKEILIDSL | -7.36995 | -7.36995 |
Top |
Vaccine Design for the FusionNeoAntigens of MAPKAPK5-CCDC38 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 12 | 20 | KEILIDSL | AAGGAAATACTGATAGACTCACTT |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 6 | 15 | DMDKAIKEI | GACATGGACAAAGCCATCAAGGAAATA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 11 | 26 | IKEILIDSLSKKITQ | ATCAAGGAAATACTGATAGACTCACTTAGTAAAAAGATTACTCAA |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 7 | 22 | MDKAIKEILIDSLSK | ATGGACAAAGCCATCAAGGAAATACTGATAGACTCACTTAGTAAA |
MAPKAPK5-CCDC38 | chr12 | 112280573 | chr12 | 96266238 | 8 | 23 | DKAIKEILIDSLSKK | GACAAAGCCATCAAGGAAATACTGATAGACTCACTTAGTAAAAAG |
Top |
Information of the samples that have these potential fusion neoantigens of MAPKAPK5-CCDC38 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SARC | MAPKAPK5-CCDC38 | chr12 | 112280573 | ENST00000547305 | chr12 | 96266238 | ENST00000344280 | TCGA-3B-A9HO-01A |
Top |
Potential target of CAR-T therapy development for MAPKAPK5-CCDC38 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MAPKAPK5-CCDC38 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MAPKAPK5-CCDC38 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |