Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MAVS-STK24

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MAVS-STK24
	FusionPDB ID: 51934
	FusionGDB2.0 ID: 51934
		Hgene	Tgene
	Gene symbol	MAVS	STK24
	Gene ID	57506	8428
	Gene name	mitochondrial antiviral signaling protein	serine/threonine kinase 24
	Synonyms	CARDIF\|IPS-1\|IPS1\|VISA	HEL-S-95\|MST3\|MST3B\|STE20\|STK3
	Cytomap	20p13	13q32.2
	Type of gene	protein-coding	protein-coding
	Description	mitochondrial antiviral-signaling proteinCARD adapter inducing interferon betaCARD adaptor inducing IFN-betaIFN-B promoter stimulator 1interferon beta promoter stimulator protein 1putative NF-kappa-B-activating protein 031Nvirus-induced signaling ad	serine/threonine-protein kinase 24STE20-like kinase 3STE20-like kinase MST3epididymis secretory protein Li 95mammalian STE20-like protein kinase 3serine/threonine kinase 24 (STE20 homolog, yeast)sterile 20-like kinase 3
	Modification date	20200313	20200313
	UniProtAcc	Q7Z434 Main function of 5'-partner protein: FUNCTION: Required for innate immune defense against viruses (PubMed:16125763, PubMed:16127453, PubMed:16153868, PubMed:16177806, PubMed:19631370, PubMed:20451243, PubMed:23087404, PubMed:20127681, PubMed:21170385). Acts downstream of DHX33, DDX58/RIG-I and IFIH1/MDA5, which detect intracellular dsRNA produced during viral replication, to coordinate pathways leading to the activation of NF-kappa-B, IRF3 and IRF7, and to the subsequent induction of antiviral cytokines such as IFNB and RANTES (CCL5) (PubMed:16125763, PubMed:16127453, PubMed:16153868, PubMed:16177806, PubMed:19631370, PubMed:20451243, PubMed:23087404, PubMed:25636800, PubMed:20127681, PubMed:21170385, PubMed:20628368). Peroxisomal and mitochondrial MAVS act sequentially to create an antiviral cellular state (PubMed:20451243). Upon viral infection, peroxisomal MAVS induces the rapid interferon-independent expression of defense factors that provide short-term protection, whereas mitochondrial MAVS activates an interferon-dependent signaling pathway with delayed kinetics, which amplifies and stabilizes the antiviral response (PubMed:20451243). May activate the same pathways following detection of extracellular dsRNA by TLR3 (PubMed:16153868). May protect cells from apoptosis (PubMed:16125763). {ECO:0000269\|PubMed:16125763, ECO:0000269\|PubMed:16127453, ECO:0000269\|PubMed:16153868, ECO:0000269\|PubMed:16177806, ECO:0000269\|PubMed:19631370, ECO:0000269\|PubMed:20127681, ECO:0000269\|PubMed:20451243, ECO:0000269\|PubMed:20628368, ECO:0000269\|PubMed:21170385, ECO:0000269\|PubMed:23087404, ECO:0000269\|PubMed:25636800}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000358134, ENST00000416600, ENST00000428216,	ENST00000397517, ENST00000539966, ENST00000376547, ENST00000481288,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 4 X 2=32	15 X 8 X 8=960
	# samples	4	18
	** MAII score	log2(4/32*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(18/960*10)=-2.41503749927884 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MAVS [Title/Abstract] AND STK24 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MAVS [Title/Abstract] AND STK24 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MAVS(3845435)-STK24(99171727), # samples:1
Anticipated loss of major functional domain due to fusion event.	MAVS-STK24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAVS-STK24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAVS-STK24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MAVS-STK24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MAVS	GO:0001934	positive regulation of protein phosphorylation	16127453
Hgene	MAVS	GO:0002230	positive regulation of defense response to virus by host	16127453
Hgene	MAVS	GO:0032727	positive regulation of interferon-alpha production	16127453
Hgene	MAVS	GO:0032728	positive regulation of interferon-beta production	16127453
Hgene	MAVS	GO:0032757	positive regulation of interleukin-8 production	16127453
Hgene	MAVS	GO:0032760	positive regulation of tumor necrosis factor production	16127453
Hgene	MAVS	GO:0042307	positive regulation of protein import into nucleus	18818105
Hgene	MAVS	GO:0045071	negative regulation of viral genome replication	20451243
Hgene	MAVS	GO:0045944	positive regulation of transcription by RNA polymerase II	16127453\|18818105
Hgene	MAVS	GO:0051091	positive regulation of DNA-binding transcription factor activity	16127453\|18818105
Hgene	MAVS	GO:0051607	defense response to virus	20451243
Hgene	MAVS	GO:0060340	positive regulation of type I interferon-mediated signaling pathway	16127453\|20451243
Hgene	MAVS	GO:0071651	positive regulation of chemokine (C-C motif) ligand 5 production	16127453
Hgene	MAVS	GO:0071660	positive regulation of IP-10 production	16127453
Tgene	STK24	GO:0006468	protein phosphorylation	19604147
Tgene	STK24	GO:0042542	response to hydrogen peroxide	22291017
Tgene	STK24	GO:0046777	protein autophosphorylation	17046825\|17657516

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:3845435/chr13:99171727)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MAVS (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across STK24 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000416600	MAVS	chr20	3845435	+	ENST00000397517	STK24	chr13	99171727	-	5340	1114	166	2367	733
ENST00000416600	MAVS	chr20	3845435	+	ENST00000539966	STK24	chr13	99171727	-	2569	1114	166	2310	714
ENST00000428216	MAVS	chr20	3845435	+	ENST00000397517	STK24	chr13	99171727	-	5512	1286	128	2539	803
ENST00000428216	MAVS	chr20	3845435	+	ENST00000539966	STK24	chr13	99171727	-	2741	1286	128	2482	784

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000416600	ENST00000397517	MAVS	chr20	3845435	+	STK24	chr13	99171727	-	0.001667766	0.9983322
ENST00000416600	ENST00000539966	MAVS	chr20	3845435	+	STK24	chr13	99171727	-	0.014837329	0.9851627
ENST00000428216	ENST00000397517	MAVS	chr20	3845435	+	STK24	chr13	99171727	-	0.001468472	0.99853146
ENST00000428216	ENST00000539966	MAVS	chr20	3845435	+	STK24	chr13	99171727	-	0.008875679	0.99112433

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MAVS-STK24

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MAVS	chr20	3845435	STK24	chr13	99171727	1114	316	ASTVPTDGSSRNENLKADPEELFTKL
MAVS	chr20	3845435	STK24	chr13	99171727	1286	386	ASTVPTDGSSRNENLKADPEELFTKL

Top

Potential FusionNeoAntigen Information of MAVS-STK24 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MAVS-STK24_3845435_99171727.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MAVS-STK24	chr20	3845435	chr13	99171727	1114	HLA-A30:01	SSRNENLKA	0.9422	0.877	8	17

Top

Potential FusionNeoAntigen Information of MAVS-STK24 in HLA II

MAVS-STK24_3845435_99171727.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0301	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0301	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0310	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0310	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0310	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0313	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0313	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0315	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0315	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0318	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0318	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0320	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0320	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0322	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0322	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0326	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0326	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0328	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0328	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0330	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0330	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0332	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0332	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0334	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0334	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0336	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0336	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0338	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0338	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0342	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0342	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0344	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0344	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0346	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0346	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0348	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0348	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0350	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0350	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0352	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0352	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0354	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-0354	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1476	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1476	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1476	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1479	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1479	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1479	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1525	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB1-1525	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0101	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0101	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0101	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0104	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0104	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0104	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0105	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0105	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0105	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0108	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0108	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0108	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0109	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0109	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0109	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0111	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0111	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0111	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0112	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0112	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0112	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0113	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0113	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0113	SRNENLKADPEELFT	9	24
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0114	RNENLKADPEELFTK	10	25
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0114	NENLKADPEELFTKL	11	26
MAVS-STK24	chr20	3845435	chr13	99171727	1114	DRB3-0114	SRNENLKADPEELFT	9	24

Top

Fusion breakpoint peptide structures of MAVS-STK24

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1128	DGSSRNENLKADPE	MAVS	STK24	chr20	3845435	chr13	99171727	1114

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MAVS-STK24

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1128	DGSSRNENLKADPE	-7.15543	-7.26883
HLA-B14:02	3BVN	1128	DGSSRNENLKADPE	-4.77435	-5.80965
HLA-B52:01	3W39	1128	DGSSRNENLKADPE	-6.80875	-6.92215
HLA-B52:01	3W39	1128	DGSSRNENLKADPE	-4.20386	-5.23916
HLA-A11:01	4UQ2	1128	DGSSRNENLKADPE	-7.5194	-8.5547
HLA-A11:01	4UQ2	1128	DGSSRNENLKADPE	-6.9601	-7.0735
HLA-A24:02	5HGA	1128	DGSSRNENLKADPE	-7.52403	-7.63743
HLA-A24:02	5HGA	1128	DGSSRNENLKADPE	-5.82433	-6.85963
HLA-B27:05	6PYJ	1128	DGSSRNENLKADPE	-3.28285	-4.31815
HLA-B44:05	3DX8	1128	DGSSRNENLKADPE	-5.91172	-6.94702
HLA-B44:05	3DX8	1128	DGSSRNENLKADPE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of MAVS-STK24

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MAVS-STK24	chr20	3845435	chr13	99171727	8	17	SSRNENLKA	AGCAGCAGAAATGAGAACCTAAAGGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MAVS-STK24	chr20	3845435	chr13	99171727	10	25	RNENLKADPEELFTK	AGAAATGAGAACCTAAAGGCAGACCCAGAAGAGCTTTTTACAAAA
MAVS-STK24	chr20	3845435	chr13	99171727	11	26	NENLKADPEELFTKL	AATGAGAACCTAAAGGCAGACCCAGAAGAGCTTTTTACAAAACTA
MAVS-STK24	chr20	3845435	chr13	99171727	9	24	SRNENLKADPEELFT	AGCAGAAATGAGAACCTAAAGGCAGACCCAGAAGAGCTTTTTACA

Top

Information of the samples that have these potential fusion neoantigens of MAVS-STK24

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	MAVS-STK24	chr20	3845435	ENST00000416600	chr13	99171727	ENST00000397517	TCGA-29-1770-01A

Top

Potential target of CAR-T therapy development for MAVS-STK24

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MAVS-STK24

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MAVS-STK24

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)