Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MAX-VTI1B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MAX-VTI1B
	FusionPDB ID: 51941
	FusionGDB2.0 ID: 51941
		Hgene	Tgene
	Gene symbol	MAX	VTI1B
	Gene ID	4149	10490
	Gene name	MYC associated factor X	vesicle transport through interaction with t-SNAREs 1B
	Synonyms	bHLHd4	VTI1\|VTI1-LIKE\|VTI1L\|VTI2\|v-SNARE\|vti1-rp1
	Cytomap	14q23.3	14q24.1
	Type of gene	protein-coding	protein-coding
	Description	protein maxclass D basic helix-loop-helix protein 4	vesicle transport through interaction with t-SNAREs homolog 1Bvesicle transport v-SNARE protein Vti1-like 1vesicle-associated soluble NSF attachment protein receptor
	Modification date	20200313	20200313
	UniProtAcc	P61244 Main function of 5'-partner protein: FUNCTION: Transcription regulator. Forms a sequence-specific DNA-binding protein complex with MYC or MAD which recognizes the core sequence 5'-CAC[GA]TG-3'. The MYC:MAX complex is a transcriptional activator, whereas the MAD:MAX complex is a repressor. May repress transcription via the recruitment of a chromatin remodeling complex containing H3 'Lys-9' histone methyltransferase activity. Represses MYC transcriptional activity from E-box elements. {ECO:0000269\|PubMed:26070438}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000557277, ENST00000246163, ENST00000284165, ENST00000341653, ENST00000358402, ENST00000358664, ENST00000555667, ENST00000556443, ENST00000556979, ENST00000557746, ENST00000555419, ENST00000555932,	ENST00000554659,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 4 X 6=144	6 X 6 X 4=144
	# samples	6	8
	** MAII score	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/144*10)=-0.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MAX [Title/Abstract] AND VTI1B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MAX [Title/Abstract] AND VTI1B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MAX(65560425)-VTI1B(68126639), # samples:1
Anticipated loss of major functional domain due to fusion event.	MAX-VTI1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAX-VTI1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MAX-VTI1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MAX-VTI1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MAX	GO:0000122	negative regulation of transcription by RNA polymerase II	8521822
Tgene	VTI1B	GO:1903076	regulation of protein localization to plasma membrane	18570918

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:65560425/chr14:68126639)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MAX (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across VTI1B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000341653	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5054	219	48	743	231
ENST00000358402	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5144	309	165	833	222
ENST00000284165	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5155	320	149	844	231
ENST00000358664	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5137	302	131	826	231
ENST00000556979	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5184	349	178	873	231
ENST00000555667	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5157	322	178	846	222
ENST00000557746	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5157	322	178	846	222
ENST00000556443	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5157	322	178	846	222
ENST00000246163	MAX	chr14	65560425	-	ENST00000554659	VTI1B	chr14	68126639	-	5176	341	170	865	231

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000341653	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000700421	0.9992995
ENST00000358402	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000811474	0.9991885
ENST00000284165	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000712618	0.9992874
ENST00000358664	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000705944	0.99929404
ENST00000556979	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000694057	0.99930596
ENST00000555667	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000810648	0.9991893
ENST00000557746	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000810648	0.9991893
ENST00000556443	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000810648	0.9991893
ENST00000246163	ENST00000554659	MAX	chr14	65560425	-	VTI1B	chr14	68126639	-	0.000690395	0.99930966

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MAX-VTI1B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MAX	chr14	65560425	VTI1B	chr14	68126639	219	57	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	302	57	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	309	48	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	320	57	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	322	48	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	341	57	SLRDSVPSLQGEKLAEMEEELRYAPL
MAX	chr14	65560425	VTI1B	chr14	68126639	349	57	SLRDSVPSLQGEKLAEMEEELRYAPL

Top

Potential FusionNeoAntigen Information of MAX-VTI1B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MAX-VTI1B_65560425_68126639.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:01	LQGEKLAEM	0.9992	0.8682	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:22	KLAEMEEEL	0.9983	0.6546	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:67	KLAEMEEEL	0.998	0.7072	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:24	KLAEMEEEL	0.998	0.7072	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:30	KLAEMEEEL	0.998	0.7072	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:60	KLAEMEEEL	0.998	0.6618	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:11	KLAEMEEEL	0.9977	0.7446	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:16	KLAEMEEEL	0.9971	0.6535	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:04	KLAEMEEEL	0.997	0.6747	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:27	KLAEMEEEL	0.9969	0.6988	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:21	KLAEMEEEL	0.9967	0.812	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:13	KLAEMEEEL	0.9965	0.7718	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:38	KLAEMEEEL	0.9938	0.744	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B48:01	LQGEKLAEM	0.979	0.6459	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:35	KLAEMEEEL	0.9617	0.7419	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:03	VPSLQGEKL	0.9315	0.8969	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:03	LQGEKLAEM	0.9295	0.82	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:29	KLAEMEEEL	0.8985	0.7138	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:08	VPSLQGEKL	0.8848	0.8306	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:20	KLAEMEEEL	0.8623	0.7152	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:05	VPSLQGEKL	0.7696	0.6191	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:02	VPSLQGEKL	0.6741	0.9494	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:04	VPSLQGEKL	0.6741	0.9494	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B13:01	LQGEKLAEM	0.6057	0.988	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B13:02	KLAEMEEEL	0.1024	0.6728	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B13:01	KLAEMEEEL	0.0881	0.9927	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B47:01	KLAEMEEELRY	0.983	0.7163	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B44:03	KLAEMEEELRY	0.9543	0.9798	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:07	KLAEMEEEL	0.9981	0.7151	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:01	KLAEMEEEL	0.998	0.7072	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:05	KLAEMEEEL	0.9975	0.5196	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:04	LQGEKLAEM	0.9874	0.8955	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B07:12	VPSLQGEKL	0.807	0.5022	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:12	VPSLQGEKL	0.6741	0.9494	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B39:08	KLAEMEEEL	0.359	0.9532	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B39:10	VPSLQGEKL	0.1926	0.914	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B42:02	VPSLQGEKL	0.1626	0.6064	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B42:01	VPSLQGEKL	0.1351	0.5953	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-C01:17	SVPSLQGEKL	0.9332	0.947	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B07:12	SVPSLQGEKL	0.6263	0.5506	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B39:10	SVPSLQGEKL	0.3053	0.9152	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:05	KLAEMEEELRY	0.9989	0.9371	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:34	LQGEKLAEM	0.9992	0.8682	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:33	LQGEKLAEM	0.9992	0.8682	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:125	LQGEKLAEM	0.9992	0.8682	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:50	LQGEKLAEM	0.9991	0.8748	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:14	KLAEMEEEL	0.9968	0.7471	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:03	KLAEMEEEL	0.9968	0.7534	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-A02:06	KLAEMEEEL	0.9967	0.812	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:12	LQGEKLAEM	0.9882	0.9158	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:53	LQGEKLAEM	0.9753	0.8596	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:54	LQGEKLAEM	0.9728	0.8371	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-C01:03	KLAEMEEEL	0.9674	0.9697	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:73	LQGEKLAEM	0.9619	0.98	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:73	KLAEMEEEL	0.9335	0.9613	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:30	LQGEKLAEM	0.926	0.9642	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:13	VPSLQGEKL	0.9209	0.8987	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:30	VPSLQGEKL	0.7777	0.7614	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:17	VPSLQGEKL	0.7777	0.7614	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:30	KLAEMEEEL	0.7648	0.9421	12	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:09	VPSLQGEKL	0.6741	0.9494	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B40:21	LQGEKLAEM	0.6617	0.6418	8	17
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B67:01	VPSLQGEKL	0.2288	0.7126	5	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-C01:03	SVPSLQGEKL	0.9789	0.9334	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-C01:02	SVPSLQGEKL	0.9431	0.9441	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B67:01	SVPSLQGEKL	0.3271	0.8184	4	14
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:135	KLAEMEEELRY	1	0.9406	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:53	KLAEMEEELRY	0.9997	0.9302	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B40:04	GEKLAEMEEEL	0.9995	0.7613	10	21
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B15:20	KLAEMEEELRY	0.9989	0.9553	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B35:28	KLAEMEEELRY	0.9982	0.9549	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B48:02	KLAEMEEELRY	0.9818	0.9474	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B44:07	KLAEMEEELRY	0.9543	0.9798	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B44:26	KLAEMEEELRY	0.9543	0.9798	12	23
MAX-VTI1B	chr14	65560425	chr14	68126639	341	HLA-B44:13	KLAEMEEELRY	0.9543	0.9798	12	23

Top

Potential FusionNeoAntigen Information of MAX-VTI1B in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MAX-VTI1B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6995	PSLQGEKLAEMEEE	MAX	VTI1B	chr14	65560425	chr14	68126639	341

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MAX-VTI1B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6995	PSLQGEKLAEMEEE	-7.15543	-7.26883
HLA-B14:02	3BVN	6995	PSLQGEKLAEMEEE	-4.77435	-5.80965
HLA-B52:01	3W39	6995	PSLQGEKLAEMEEE	-6.80875	-6.92215
HLA-B52:01	3W39	6995	PSLQGEKLAEMEEE	-4.20386	-5.23916
HLA-A11:01	4UQ2	6995	PSLQGEKLAEMEEE	-7.5194	-8.5547
HLA-A11:01	4UQ2	6995	PSLQGEKLAEMEEE	-6.9601	-7.0735
HLA-A24:02	5HGA	6995	PSLQGEKLAEMEEE	-7.52403	-7.63743
HLA-A24:02	5HGA	6995	PSLQGEKLAEMEEE	-5.82433	-6.85963
HLA-B27:05	6PYJ	6995	PSLQGEKLAEMEEE	-3.28285	-4.31815
HLA-B44:05	3DX8	6995	PSLQGEKLAEMEEE	-5.91172	-6.94702
HLA-B44:05	3DX8	6995	PSLQGEKLAEMEEE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of MAX-VTI1B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MAX-VTI1B	chr14	65560425	chr14	68126639	10	21	GEKLAEMEEEL	GGAGAGAAGCTGGCAGAGATGGAGGAGGAGCTA
MAX-VTI1B	chr14	65560425	chr14	68126639	12	21	KLAEMEEEL	AAGCTGGCAGAGATGGAGGAGGAGCTA
MAX-VTI1B	chr14	65560425	chr14	68126639	12	23	KLAEMEEELRY	AAGCTGGCAGAGATGGAGGAGGAGCTACGTTAT
MAX-VTI1B	chr14	65560425	chr14	68126639	4	14	SVPSLQGEKL	TCAGTCCCATCACTCCAAGGAGAGAAGCTG
MAX-VTI1B	chr14	65560425	chr14	68126639	5	14	VPSLQGEKL	GTCCCATCACTCCAAGGAGAGAAGCTG
MAX-VTI1B	chr14	65560425	chr14	68126639	8	17	LQGEKLAEM	CTCCAAGGAGAGAAGCTGGCAGAGATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MAX-VTI1B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	MAX-VTI1B	chr14	65560425	ENST00000246163	chr14	68126639	ENST00000554659	TCGA-D7-A74A

Top

Potential target of CAR-T therapy development for MAX-VTI1B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

VTI1B

chr14:65560425

chr14:68126639

ENST00000554659

209_229

233.0

Transmembrane

Helical%3B Anchor for type IV membrane protein

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MAX-VTI1B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MAX-VTI1B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)