![]() |
|||||||
|
Fusion Protein:MDM2-XPOT |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MDM2-XPOT | FusionPDB ID: 52427 | FusionGDB2.0 ID: 52427 | Hgene | Tgene | Gene symbol | MDM2 | XPOT | Gene ID | 4193 | 11260 |
Gene name | MDM2 proto-oncogene | exportin for tRNA | |
Synonyms | ACTFS|HDMX|LSKB|hdm2 | XPO3 | |
Cytomap | 12q15 | 12q14.2 | |
Type of gene | protein-coding | protein-coding | |
Description | E3 ubiquitin-protein ligase Mdm2MDM2 oncogene, E3 ubiquitin protein ligaseMDM2 proto-oncogene, E3 ubiquitin protein ligaseMdm2, p53 E3 ubiquitin protein ligase homologMdm2, transformed 3T3 cell double minute 2, p53 binding proteindouble minute 2, hum | exportin-Texportin(tRNA)exportin, tRNA (nuclear export receptor for tRNAs)tRNA exportin | |
Modification date | 20200329 | 20200313 | |
UniProtAcc | Q00987 Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its transcriptional activation domain. Also acts as a ubiquitin ligase E3 toward itself and ARRB1. Permits the nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1 protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also component of the TRIM28/KAP1-ERBB4-MDM2 complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal degradation (PubMed:12821780, PubMed:15053880, PubMed:15195100, PubMed:15632057, PubMed:16337594, PubMed:17290220, PubMed:19098711, PubMed:19219073, PubMed:19837670, PubMed:19965871, PubMed:20173098, PubMed:20385133, PubMed:20858735, PubMed:22128911). Ubiquitinates DCX, leading to DCX degradation and reduction of the dendritic spine density of olfactory bulb granule cells (By similarity). Ubiquitinates DLG4, leading to proteasomal degradation of DLG4 which is required for AMPA receptor endocytosis (By similarity). Negatively regulates NDUFS1, leading to decreased mitochondrial respiration, marked oxidative stress, and commitment to the mitochondrial pathway of apoptosis (PubMed:30879903). Binds NDUFS1 leading to its cytosolic retention rather than mitochondrial localization resulting in decreased supercomplex assembly (interactions between complex I and complex III), decreased complex I activity, ROS production, and apoptosis (PubMed:30879903). {ECO:0000250|UniProtKB:P23804, ECO:0000269|PubMed:12821780, ECO:0000269|PubMed:15053880, ECO:0000269|PubMed:15195100, ECO:0000269|PubMed:15632057, ECO:0000269|PubMed:16337594, ECO:0000269|PubMed:17290220, ECO:0000269|PubMed:19098711, ECO:0000269|PubMed:19219073, ECO:0000269|PubMed:19837670, ECO:0000269|PubMed:19965871, ECO:0000269|PubMed:20173098, ECO:0000269|PubMed:20385133, ECO:0000269|PubMed:20858735, ECO:0000269|PubMed:22128911, ECO:0000269|PubMed:30879903}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000258148, ENST00000258149, ENST00000350057, ENST00000462284, ENST00000299252, ENST00000348801, ENST00000356290, ENST00000360430, ENST00000393410, ENST00000393412, ENST00000393413, ENST00000428863, ENST00000478070, ENST00000517852, ENST00000540827, ENST00000544125, ENST00000544561, ENST00000545204, | ENST00000332707, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 39 X 20 X 11=8580 | 10 X 11 X 6=660 |
# samples | 47 | 12 | |
** MAII score | log2(47/8580*10)=-4.19024498582191 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(12/660*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MDM2 [Title/Abstract] AND XPOT [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MDM2 [Title/Abstract] AND XPOT [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MDM2(69222710)-XPOT(64833023), # samples:1 MDM2(69222711)-XPOT(64833023), # samples:1 MDM2(69222711)-XPOT(64833024), # samples:1 MDM2(69222711)-XPOT(64838855), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | MDM2-XPOT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MDM2-XPOT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MDM2-XPOT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MDM2-XPOT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MDM2 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 9271120|17310983 |
Hgene | MDM2 | GO:0006511 | ubiquitin-dependent protein catabolic process | 11278372|15314173|16173922|17310983 |
Hgene | MDM2 | GO:0016567 | protein ubiquitination | 9450543|15878855|19656744|20153724 |
Hgene | MDM2 | GO:0031648 | protein destabilization | 9529249|10360174|15314173 |
Hgene | MDM2 | GO:0032436 | positive regulation of proteasomal ubiquitin-dependent protein catabolic process | 11278372 |
Hgene | MDM2 | GO:0034504 | protein localization to nucleus | 10360174 |
Hgene | MDM2 | GO:0042176 | regulation of protein catabolic process | 9153395 |
Hgene | MDM2 | GO:0043518 | negative regulation of DNA damage response, signal transduction by p53 class mediator | 9529249|10360174 |
Hgene | MDM2 | GO:0045184 | establishment of protein localization | 10360174 |
Hgene | MDM2 | GO:0045892 | negative regulation of transcription, DNA-templated | 9271120 |
Hgene | MDM2 | GO:0065003 | protein-containing complex assembly | 10608892|12915590 |
Hgene | MDM2 | GO:0071157 | negative regulation of cell cycle arrest | 9529249 |
Hgene | MDM2 | GO:0071480 | cellular response to gamma radiation | 16213212 |
Hgene | MDM2 | GO:0072717 | cellular response to actinomycin D | 15314173 |
Hgene | MDM2 | GO:1901797 | negative regulation of signal transduction by p53 class mediator | 16173922 |
Tgene | XPOT | GO:0006409 | tRNA export from nucleus | 9660920 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:69222710/chr12:64833023) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000462284 | MDM2 | chr12 | 69222710 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 4138 | 986 | 266 | 1141 | 291 |
ENST00000258149 | MDM2 | chr12 | 69222710 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3958 | 806 | 251 | 961 | 236 |
ENST00000258148 | MDM2 | chr12 | 69222710 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3685 | 533 | 14 | 688 | 224 |
ENST00000350057 | MDM2 | chr12 | 69222710 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3743 | 591 | 0 | 746 | 248 |
ENST00000462284 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 4138 | 986 | 266 | 1141 | 291 |
ENST00000258149 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3958 | 806 | 251 | 961 | 236 |
ENST00000258148 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3685 | 533 | 14 | 688 | 224 |
ENST00000350057 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833023 | + | 3743 | 591 | 0 | 746 | 248 |
ENST00000462284 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833024 | + | 4138 | 986 | 266 | 1141 | 291 |
ENST00000258149 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833024 | + | 3958 | 806 | 251 | 961 | 236 |
ENST00000258148 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833024 | + | 3685 | 533 | 14 | 688 | 224 |
ENST00000350057 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64833024 | + | 3743 | 591 | 0 | 746 | 248 |
ENST00000462284 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64838855 | + | 4066 | 986 | 266 | 1069 | 267 |
ENST00000258149 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64838855 | + | 3886 | 806 | 251 | 889 | 212 |
ENST00000258148 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64838855 | + | 3613 | 533 | 14 | 616 | 200 |
ENST00000350057 | MDM2 | chr12 | 69222711 | + | ENST00000332707 | XPOT | chr12 | 64838855 | + | 3671 | 591 | 0 | 674 | 224 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000462284 | ENST00000332707 | MDM2 | chr12 | 69222710 | + | XPOT | chr12 | 64833023 | + | 0.000669807 | 0.99933016 |
ENST00000258149 | ENST00000332707 | MDM2 | chr12 | 69222710 | + | XPOT | chr12 | 64833023 | + | 0.001310336 | 0.9986897 |
ENST00000258148 | ENST00000332707 | MDM2 | chr12 | 69222710 | + | XPOT | chr12 | 64833023 | + | 0.001046507 | 0.99895346 |
ENST00000350057 | ENST00000332707 | MDM2 | chr12 | 69222710 | + | XPOT | chr12 | 64833023 | + | 0.001316193 | 0.99868375 |
ENST00000462284 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833023 | + | 0.000669807 | 0.99933016 |
ENST00000258149 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833023 | + | 0.001310336 | 0.9986897 |
ENST00000258148 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833023 | + | 0.001046507 | 0.99895346 |
ENST00000350057 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833023 | + | 0.001316193 | 0.99868375 |
ENST00000462284 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833024 | + | 0.000669807 | 0.99933016 |
ENST00000258149 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833024 | + | 0.001310336 | 0.9986897 |
ENST00000258148 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833024 | + | 0.001046507 | 0.99895346 |
ENST00000350057 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64833024 | + | 0.001316193 | 0.99868375 |
ENST00000462284 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64838855 | + | 0.002744624 | 0.9972554 |
ENST00000258149 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64838855 | + | 0.004897973 | 0.99510205 |
ENST00000258148 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64838855 | + | 0.003939658 | 0.9960603 |
ENST00000350057 | ENST00000332707 | MDM2 | chr12 | 69222711 | + | XPOT | chr12 | 64838855 | + | 0.001123785 | 0.99887615 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MDM2-XPOT |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MDM2 | chr12 | 69222710 | XPOT | chr12 | 64833023 | 533 | 173 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222710 | XPOT | chr12 | 64833023 | 591 | 197 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222710 | XPOT | chr12 | 64833023 | 806 | 185 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222710 | XPOT | chr12 | 64833023 | 986 | 240 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833023 | 533 | 173 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833023 | 591 | 197 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833023 | 806 | 185 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833023 | 986 | 240 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833024 | 533 | 173 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833024 | 591 | 197 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833024 | 806 | 185 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64833024 | 986 | 240 | SSSSESTGTPSNPGPECVQYLQQEYL |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64838855 | 533 | 173 | SSSSESTGTPSNPEFCQALQQPDAKV |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64838855 | 591 | 197 | SSSSESTGTPSNPEFCQALQQPDAKV |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64838855 | 806 | 185 | SSSSESTGTPSNPEFCQALQQPDAKV |
MDM2 | chr12 | 69222711 | XPOT | chr12 | 64838855 | 986 | 240 | SSSSESTGTPSNPEFCQALQQPDAKV |
Top |
Potential FusionNeoAntigen Information of MDM2-XPOT in HLA I |
![]() |
MDM2-XPOT_69222710_64833023.msa | |
MDM2-XPOT_69222711_64838855.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:01 | NPGPECVQY | 0.9824 | 0.8523 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:08 | NPGPECVQY | 0.9698 | 0.6726 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:02 | TPSNPGPEC | 0.2729 | 0.9406 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:04 | TPSNPGPEC | 0.2729 | 0.9406 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:08 | SNPGPECVQY | 0.8764 | 0.584 | 10 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:01 | SNPGPECVQY | 0.828 | 0.5657 | 10 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:03 | NPGPECVQYL | 0.7026 | 0.8143 | 11 | 21 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B15:31 | NPGPECVQY | 0.9819 | 0.8108 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B07:12 | TPSNPGPEC | 0.7126 | 0.5602 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:12 | TPSNPGPEC | 0.2729 | 0.9406 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B78:01 | TPSNPGPEC | 0.0979 | 0.5304 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B39:10 | TPSNPGPEC | 0.0088 | 0.8692 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:77 | NPGPECVQY | 0.9824 | 0.8523 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:23 | NPGPECVQY | 0.9803 | 0.8564 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:20 | NPGPECVQY | 0.9785 | 0.9083 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:24 | NPGPECVQY | 0.9601 | 0.8861 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:11 | NPGPECVQY | 0.9092 | 0.8608 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:30 | NPGPECVQY | 0.8493 | 0.5624 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:17 | NPGPECVQY | 0.8493 | 0.5624 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B18:04 | NPGPECVQY | 0.4131 | 0.8471 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:09 | TPSNPGPEC | 0.2729 | 0.9406 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B18:07 | NPGPECVQY | 0.1545 | 0.7955 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B15:08 | NPGPECVQY | 0.1175 | 0.7923 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B15:11 | NPGPECVQY | 0.1124 | 0.7941 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B18:08 | NPGPECVQY | 0.1112 | 0.7621 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:43 | NPGPECVQY | 0.1047 | 0.7865 | 11 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B78:02 | TPSNPGPEC | 0.0746 | 0.6761 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B67:01 | TPSNPGPEC | 0.0272 | 0.8574 | 8 | 17 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B15:11 | SNPGPECVQY | 0.9533 | 0.6593 | 10 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B35:77 | SNPGPECVQY | 0.828 | 0.5657 | 10 | 20 |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 | HLA-B67:01 | TPSNPGPECV | 0.3359 | 0.836 | 8 | 18 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B15:17 | STGTPSNPEF | 0.9665 | 0.9601 | 5 | 15 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B57:03 | STGTPSNPEF | 0.9626 | 0.9928 | 5 | 15 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B35:03 | TPSNPEFCQAL | 0.9666 | 0.8401 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B35:02 | TPSNPEFCQAL | 0.9119 | 0.9187 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B35:04 | TPSNPEFCQAL | 0.9119 | 0.9187 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B39:09 | SNPEFCQAL | 0.8373 | 0.5284 | 10 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-C01:17 | SNPEFCQAL | 0.8208 | 0.8795 | 10 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-C01:30 | SNPEFCQAL | 0.7157 | 0.9213 | 10 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B35:12 | TPSNPEFCQAL | 0.9119 | 0.9187 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B39:10 | TPSNPEFCQAL | 0.9016 | 0.8448 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-C01:02 | SNPEFCQAL | 0.8591 | 0.8763 | 10 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-C01:03 | SNPEFCQAL | 0.8345 | 0.7909 | 10 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B57:04 | STGTPSNPEF | 0.987 | 0.7942 | 5 | 15 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B57:02 | STGTPSNPEF | 0.9632 | 0.9512 | 5 | 15 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B35:09 | TPSNPEFCQAL | 0.9119 | 0.9187 | 8 | 19 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | HLA-B67:01 | TPSNPEFCQAL | 0.8849 | 0.7959 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of MDM2-XPOT in HLA II |
![]() |
MDM2-XPOT_69222711_64838855.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | DRB1-0908 | NPEFCQALQQPDAKV | 11 | 26 |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 | DRB1-0908 | SNPEFCQALQQPDAK | 10 | 25 |
Top |
Fusion breakpoint peptide structures of MDM2-XPOT |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9377 | TGTPSNPEFCQALQ | MDM2 | XPOT | chr12 | 69222711 | chr12 | 64838855 | 533 |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9378 | TGTPSNPGPECVQY | MDM2 | XPOT | chr12 | 69222710 | chr12 | 64833023 | 533 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MDM2-XPOT |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9377 | TGTPSNPEFCQALQ | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9377 | TGTPSNPEFCQALQ | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9377 | TGTPSNPEFCQALQ | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9377 | TGTPSNPEFCQALQ | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9377 | TGTPSNPEFCQALQ | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9377 | TGTPSNPEFCQALQ | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9377 | TGTPSNPEFCQALQ | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9377 | TGTPSNPEFCQALQ | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9377 | TGTPSNPEFCQALQ | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9377 | TGTPSNPEFCQALQ | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9377 | TGTPSNPEFCQALQ | -4.24346 | -4.35686 |
HLA-B14:02 | 3BVN | 9378 | TGTPSNPGPECVQY | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9378 | TGTPSNPGPECVQY | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9378 | TGTPSNPGPECVQY | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9378 | TGTPSNPGPECVQY | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9378 | TGTPSNPGPECVQY | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9378 | TGTPSNPGPECVQY | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9378 | TGTPSNPGPECVQY | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9378 | TGTPSNPGPECVQY | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9378 | TGTPSNPGPECVQY | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9378 | TGTPSNPGPECVQY | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9378 | TGTPSNPGPECVQY | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of MDM2-XPOT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 10 | 20 | SNPGPECVQY | TCGAATCCGGGCCCAGAATGTGTTCAGTAT |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 11 | 20 | NPGPECVQY | AATCCGGGCCCAGAATGTGTTCAGTAT |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 11 | 21 | NPGPECVQYL | AATCCGGGCCCAGAATGTGTTCAGTATCTT |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 8 | 17 | TPSNPGPEC | ACGCCATCGAATCCGGGCCCAGAATGT |
MDM2-XPOT | chr12 | 69222710 | chr12 | 64833023 | 8 | 18 | TPSNPGPECV | ACGCCATCGAATCCGGGCCCAGAATGTGTT |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 10 | 19 | SNPEFCQAL | TCGAATCCGGAGTTTTGTCAAGCGCTT |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 5 | 15 | STGTPSNPEF | TCTACAGGGACGCCATCGAATCCGGAGTTT |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 8 | 19 | TPSNPEFCQAL | ACGCCATCGAATCCGGAGTTTTGTCAAGCGCTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 10 | 25 | SNPEFCQALQQPDAK | TCGAATCCGGAGTTTTGTCAAGCGCTTCAGCAGCCTGATGCTAAA |
MDM2-XPOT | chr12 | 69222711 | chr12 | 64838855 | 11 | 26 | NPEFCQALQQPDAKV | AATCCGGAGTTTTGTCAAGCGCTTCAGCAGCCTGATGCTAAAGTT |
Top |
Information of the samples that have these potential fusion neoantigens of MDM2-XPOT |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | MDM2-XPOT | chr12 | 69222710 | ENST00000258148 | chr12 | 64833023 | ENST00000332707 | TCGA-AN-A0AM-01A |
BRCA | MDM2-XPOT | chr12 | 69222711 | ENST00000258148 | chr12 | 64838855 | ENST00000332707 | TCGA-AN-A0AM-01A |
Top |
Potential target of CAR-T therapy development for MDM2-XPOT |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MDM2-XPOT |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MDM2-XPOT |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |