Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MEF2A-BRE

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MEF2A-BRE
	FusionPDB ID: 52795
	FusionGDB2.0 ID: 52795
		Hgene	Tgene
	Gene symbol	MEF2A	BRE
	Gene ID	4205	9577
	Gene name	myocyte enhancer factor 2A	BRISC and BRCA1 A complex member 2
	Synonyms	ADCAD1\|RSRFC4\|RSRFC9\|mef2	BRCC4\|BRCC45\|BRE
	Cytomap	15q26.3	2p23.2
	Type of gene	protein-coding	protein-coding
	Description	myocyte-specific enhancer factor 2AMADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A)serum response factor-like protein 1	BRISC and BRCA1-A complex member 2BRCA1-A complex subunit BREBRCA1/BRCA2-containing complex subunit 45BRCA1/BRCA2-containing complex, subunit 4brain and reproductive organ-expressed (TNFRSF1A modulator)brain and reproductive organ-expressed protein
	Modification date	20200313	20200313
	UniProtAcc	Q02078 Main function of 5'-partner protein: FUNCTION: Transcriptional activator which binds specifically to the MEF2 element, 5'-YTA[AT](4)TAR-3', found in numerous muscle-specific genes. Also involved in the activation of numerous growth factor- and stress-induced genes. Mediates cellular functions not only in skeletal and cardiac muscle development, but also in neuronal differentiation and survival. Plays diverse roles in the control of cell growth, survival and apoptosis via p38 MAPK signaling in muscle-specific and/or growth factor-related transcription. In cerebellar granule neurons, phosphorylated and sumoylated MEF2A represses transcription of NUR77 promoting synaptic differentiation. Associates with chromatin to the ZNF16 promoter. {ECO:0000269\|PubMed:11904443, ECO:0000269\|PubMed:12691662, ECO:0000269\|PubMed:15834131, ECO:0000269\|PubMed:16371476, ECO:0000269\|PubMed:16484498, ECO:0000269\|PubMed:16563226, ECO:0000269\|PubMed:21468593, ECO:0000269\|PubMed:9858528}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000558856, ENST00000338042, ENST00000354410, ENST00000449277, ENST00000453228, ENST00000557785, ENST00000557942, ENST00000558812,	ENST00000342045, ENST00000344773, ENST00000361704, ENST00000379624, ENST00000379632, ENST00000603461,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 13 X 7=1274	20 X 20 X 12=4800
	# samples	18	30
	** MAII score	log2(18/1274*10)=-2.82329646592663 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(30/4800*10)=-4 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MEF2A [Title/Abstract] AND BRE [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MEF2A [Title/Abstract] AND BRE [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MEF2A(100173378)-BRE(28268591), # samples:1
Anticipated loss of major functional domain due to fusion event.	MEF2A-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MEF2A-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MEF2A-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MEF2A-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MEF2A	GO:0000122	negative regulation of transcription by RNA polymerase II	16484498
Hgene	MEF2A	GO:0000165	MAPK cascade	9858528
Hgene	MEF2A	GO:0006351	transcription, DNA-templated	16043483
Hgene	MEF2A	GO:0010613	positive regulation of cardiac muscle hypertrophy	24161931
Hgene	MEF2A	GO:0045944	positive regulation of transcription by RNA polymerase II	7760790\|9858528\|10748098\|15466416\|20590529\|21468593
Hgene	MEF2A	GO:0071277	cellular response to calcium ion	16484498
Tgene	BRE	GO:0043066	negative regulation of apoptotic process	15465831

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:100173378/chr2:28268591)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MEF2A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BRE (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000453228	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1493	274	214	1026	270
ENST00000453228	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1319	274	214	930	238
ENST00000453228	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1319	274	214	930	238
ENST00000453228	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1391	274	214	909	231
ENST00000453228	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1391	274	214	909	231
ENST00000354410	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1902	683	623	1435	270
ENST00000354410	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1728	683	623	1339	238
ENST00000354410	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1728	683	623	1339	238
ENST00000354410	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1800	683	623	1318	231
ENST00000354410	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1800	683	623	1318	231
ENST00000558812	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1592	373	313	1125	270
ENST00000558812	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1418	373	313	1029	238
ENST00000558812	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1418	373	313	1029	238
ENST00000558812	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1490	373	313	1008	231
ENST00000558812	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1490	373	313	1008	231
ENST00000338042	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1592	373	313	1125	270
ENST00000338042	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1418	373	313	1029	238
ENST00000338042	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1418	373	313	1029	238
ENST00000338042	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1490	373	313	1008	231
ENST00000338042	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1490	373	313	1008	231
ENST00000557785	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1622	403	343	1155	270
ENST00000557785	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1448	403	343	1059	238
ENST00000557785	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1448	403	343	1059	238
ENST00000557785	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1520	403	343	1038	231
ENST00000557785	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1520	403	343	1038	231
ENST00000449277	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1530	311	251	1063	270
ENST00000449277	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1356	311	251	967	238
ENST00000449277	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1356	311	251	967	238
ENST00000449277	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1428	311	251	946	231
ENST00000449277	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1428	311	251	946	231
ENST00000557942	MEF2A	chr15	100173378	+	ENST00000344773	BRE	chr2	28268591	+	1515	296	236	1048	270
ENST00000557942	MEF2A	chr15	100173378	+	ENST00000379624	BRE	chr2	28268591	+	1341	296	236	952	238
ENST00000557942	MEF2A	chr15	100173378	+	ENST00000342045	BRE	chr2	28268591	+	1341	296	236	952	238
ENST00000557942	MEF2A	chr15	100173378	+	ENST00000379632	BRE	chr2	28268591	+	1413	296	236	931	231
ENST00000557942	MEF2A	chr15	100173378	+	ENST00000361704	BRE	chr2	28268591	+	1413	296	236	931	231

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000453228	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.027503412	0.9724966
ENST00000453228	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.00580103	0.9941989
ENST00000453228	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.00580103	0.9941989
ENST00000453228	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.007128489	0.9928716
ENST00000453228	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.007128489	0.9928716
ENST00000354410	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.023284797	0.97671515
ENST00000354410	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004444049	0.99555594
ENST00000354410	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004444049	0.99555594
ENST00000354410	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004975863	0.99502414
ENST00000354410	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004975863	0.99502414
ENST00000558812	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.021605754	0.9783942
ENST00000558812	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004179473	0.9958205
ENST00000558812	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004179473	0.9958205
ENST00000558812	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004497977	0.99550205
ENST00000558812	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004497977	0.99550205
ENST00000338042	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.021605754	0.9783942
ENST00000338042	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004179473	0.9958205
ENST00000338042	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004179473	0.9958205
ENST00000338042	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004497977	0.99550205
ENST00000338042	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004497977	0.99550205
ENST00000557785	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.022986138	0.9770139
ENST00000557785	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004065278	0.9959347
ENST00000557785	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004065278	0.9959347
ENST00000557785	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004472775	0.9955272
ENST00000557785	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004472775	0.9955272
ENST00000449277	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.022954714	0.9770453
ENST00000449277	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.003995685	0.9960043
ENST00000449277	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.003995685	0.9960043
ENST00000449277	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004691084	0.99530894
ENST00000449277	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.004691084	0.99530894
ENST00000557942	ENST00000344773	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.027819017	0.9721809
ENST00000557942	ENST00000379624	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.005170826	0.99482924
ENST00000557942	ENST00000342045	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.005170826	0.99482924
ENST00000557942	ENST00000379632	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.006555471	0.99344456
ENST00000557942	ENST00000361704	MEF2A	chr15	100173378	+	BRE	chr2	28268591	+	0.006555471	0.99344456

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MEF2A-BRE

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MEF2A	chr15	100173378	BRE	chr2	28268591	274	19	KIQITRIMDERNRQTGEFSARFLLKL
MEF2A	chr15	100173378	BRE	chr2	28268591	296	19	KIQITRIMDERNRQTGEFSARFLLKL
MEF2A	chr15	100173378	BRE	chr2	28268591	311	19	KIQITRIMDERNRQTGEFSARFLLKL
MEF2A	chr15	100173378	BRE	chr2	28268591	373	19	KIQITRIMDERNRQTGEFSARFLLKL
MEF2A	chr15	100173378	BRE	chr2	28268591	403	19	KIQITRIMDERNRQTGEFSARFLLKL
MEF2A	chr15	100173378	BRE	chr2	28268591	683	19	KIQITRIMDERNRQTGEFSARFLLKL

Top

Potential FusionNeoAntigen Information of MEF2A-BRE in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MEF2A-BRE_100173378_28268591.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B39:06	NRQTGEFSA	0.9975	0.8593	11	20
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-A31:02	RQTGEFSAR	0.9531	0.7058	12	21
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-A31:06	RQTGEFSAR	0.8912	0.5186	12	21
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:18	ERNRQTGEF	0.6137	0.5213	9	18
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:01	RQTGEFSARF	0.9999	0.9219	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:03	RQTGEFSARF	0.9529	0.9058	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:25	RQTGEFSARF	0.9459	0.9655	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B13:01	RQTGEFSARF	0.8853	0.9669	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B48:01	RQTGEFSARFL	0.9557	0.7794	12	23
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B73:01	NRQTGEFSA	0.9957	0.8085	11	20
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B39:12	NRQTGEFSA	0.9913	0.9343	11	20
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-A31:01	RQTGEFSAR	0.9748	0.6523	12	21
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B39:12	ERNRQTGEF	0.7268	0.9028	9	18
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:07	RQTGEFSARF	0.993	0.831	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:05	RQTGEFSARF	0.8684	0.9229	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B73:01	ERNRQTGEFSA	0.9982	0.8854	9	20
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B39:31	NRQTGEFSA	0.992	0.9314	11	20
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:135	RQTGEFSARF	0.9999	0.927	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:50	RQTGEFSARF	0.9999	0.8896	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:125	RQTGEFSARF	0.9999	0.9219	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:34	RQTGEFSARF	0.9999	0.9219	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:33	RQTGEFSARF	0.9999	0.9219	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:24	RQTGEFSARF	0.9998	0.9507	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:27	RQTGEFSARF	0.9998	0.9219	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:53	RQTGEFSARF	0.9991	0.9071	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:12	RQTGEFSARF	0.9984	0.7889	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:73	RQTGEFSARF	0.9944	0.9223	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:68	RQTGEFSARF	0.9926	0.78	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:54	RQTGEFSARF	0.9893	0.8948	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:35	RQTGEFSARF	0.9852	0.9117	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:39	RQTGEFSARF	0.9517	0.9245	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B48:02	RQTGEFSARF	0.8874	0.9512	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B15:20	RQTGEFSARF	0.8654	0.9473	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B35:28	RQTGEFSARF	0.8428	0.9546	12	22
MEF2A-BRE	chr15	100173378	chr2	28268591	373	HLA-B18:03	DERNRQTGEF	0.8126	0.95	8	18

Top

Potential FusionNeoAntigen Information of MEF2A-BRE in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MEF2A-BRE

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3826	IMDERNRQTGEFSA	MEF2A	BRE	chr15	100173378	chr2	28268591	373

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MEF2A-BRE

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3826	IMDERNRQTGEFSA	-7.9962	-8.1096
HLA-B14:02	3BVN	3826	IMDERNRQTGEFSA	-5.70842	-6.74372
HLA-B52:01	3W39	3826	IMDERNRQTGEFSA	-6.83737	-6.95077
HLA-B52:01	3W39	3826	IMDERNRQTGEFSA	-4.4836	-5.5189
HLA-A11:01	4UQ2	3826	IMDERNRQTGEFSA	-10.0067	-10.1201
HLA-A11:01	4UQ2	3826	IMDERNRQTGEFSA	-9.03915	-10.0745
HLA-A24:02	5HGA	3826	IMDERNRQTGEFSA	-6.56204	-6.67544
HLA-A24:02	5HGA	3826	IMDERNRQTGEFSA	-5.42271	-6.45801
HLA-B44:05	3DX8	3826	IMDERNRQTGEFSA	-7.85648	-8.89178
HLA-B44:05	3DX8	3826	IMDERNRQTGEFSA	-5.3978	-5.5112
HLA-A02:01	6TDR	3826	IMDERNRQTGEFSA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of MEF2A-BRE

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MEF2A-BRE	chr15	100173378	chr2	28268591	11	20	NRQTGEFSA	CGACAGACTGGTGAATTTTCAGCTCGT
MEF2A-BRE	chr15	100173378	chr2	28268591	12	21	RQTGEFSAR	CAGACTGGTGAATTTTCAGCTCGTTTC
MEF2A-BRE	chr15	100173378	chr2	28268591	12	22	RQTGEFSARF	CAGACTGGTGAATTTTCAGCTCGTTTCCTT
MEF2A-BRE	chr15	100173378	chr2	28268591	12	23	RQTGEFSARFL	CAGACTGGTGAATTTTCAGCTCGTTTCCTTTTG
MEF2A-BRE	chr15	100173378	chr2	28268591	8	18	DERNRQTGEF	GAAAGGAACCGACAGACTGGTGAATTTTCA
MEF2A-BRE	chr15	100173378	chr2	28268591	9	18	ERNRQTGEF	AGGAACCGACAGACTGGTGAATTTTCA
MEF2A-BRE	chr15	100173378	chr2	28268591	9	20	ERNRQTGEFSA	AGGAACCGACAGACTGGTGAATTTTCAGCTCGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MEF2A-BRE

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	MEF2A-BRE	chr15	100173378	ENST00000338042	chr2	28268591	ENST00000342045	TCGA-BR-8687

Top

Potential target of CAR-T therapy development for MEF2A-BRE

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MEF2A-BRE

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MEF2A-BRE

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)