![]() |
|||||||
|
Fusion Protein:MEN1-PTPRJ |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MEN1-PTPRJ | FusionPDB ID: 52984 | FusionGDB2.0 ID: 52984 | Hgene | Tgene | Gene symbol | MEN1 | PTPRJ | Gene ID | 4221 | 5795 |
Gene name | menin 1 | protein tyrosine phosphatase receptor type J | |
Synonyms | MEAI|SCG2 | CD148|DEP1|HPTPeta|R-PTP-ETA|SCC1 | |
Cytomap | 11q13.1 | 11p11.2 | |
Type of gene | protein-coding | protein-coding | |
Description | menin | receptor-type tyrosine-protein phosphatase etaCD148 antigenDEP-1HPTP etaR-PTP-Jdensity-enhanced phosphatase 1human density enhanced phosphatase-1protein tyrosine phosphatase, receptor type, J polypeptideprotein-tyrosine phosphatase etasusceptibil | |
Modification date | 20200320 | 20200313 | |
UniProtAcc | O00255 Main function of 5'-partner protein: FUNCTION: Essential component of a MLL/SET1 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3 (H3K4). Functions as a transcriptional regulator. Binds to the TERT promoter and represses telomerase expression. Plays a role in TGFB1-mediated inhibition of cell-proliferation, possibly regulating SMAD3 transcriptional activity. Represses JUND-mediated transcriptional activation on AP1 sites, as well as that mediated by NFKB subunit RELA. Positively regulates HOXC8 and HOXC6 gene expression. May be involved in normal hematopoiesis through the activation of HOXA9 expression (By similarity). May be involved in DNA repair. {ECO:0000250|UniProtKB:O88559, ECO:0000269|PubMed:11274402, ECO:0000269|PubMed:11526476, ECO:0000269|PubMed:12837246, ECO:0000269|PubMed:12874027, ECO:0000269|PubMed:14992727, ECO:0000269|PubMed:22327296}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000312049, ENST00000315422, ENST00000377316, ENST00000377321, ENST00000377326, ENST00000337652, ENST00000377313, ENST00000394374, ENST00000394376, ENST00000443283, ENST00000478548, | ENST00000526550, ENST00000418331, ENST00000440289, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 3 X 3=27 | 5 X 6 X 3=90 |
# samples | 3 | 6 | |
** MAII score | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(6/90*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MEN1 [Title/Abstract] AND PTPRJ [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MEN1 [Title/Abstract] AND PTPRJ [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MEN1(64577137)-PTPRJ(48149332), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. MEN1-PTPRJ seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. MEN1-PTPRJ seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. MEN1-PTPRJ seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MEN1 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 9989505|12837246|23784080 |
Hgene | MEN1 | GO:0000165 | MAPK cascade | 12226747 |
Hgene | MEN1 | GO:0001933 | negative regulation of protein phosphorylation | 12226747 |
Hgene | MEN1 | GO:0006974 | cellular response to DNA damage stimulus | 16690369 |
Hgene | MEN1 | GO:0008285 | negative regulation of cell proliferation | 15331604 |
Hgene | MEN1 | GO:0009411 | response to UV | 16690369 |
Hgene | MEN1 | GO:0010332 | response to gamma radiation | 12874027 |
Hgene | MEN1 | GO:0032092 | positive regulation of protein binding | 20484083 |
Hgene | MEN1 | GO:0043433 | negative regulation of DNA-binding transcription factor activity | 11526476|12226747 |
Hgene | MEN1 | GO:0045786 | negative regulation of cell cycle | 15331604 |
Hgene | MEN1 | GO:0045892 | negative regulation of transcription, DNA-templated | 12226747 |
Hgene | MEN1 | GO:0046329 | negative regulation of JNK cascade | 12226747 |
Tgene | PTPRJ | GO:0008285 | negative regulation of cell proliferation | 14709717|16682945 |
Tgene | PTPRJ | GO:0010642 | negative regulation of platelet-derived growth factor receptor signaling pathway | 14709717 |
Tgene | PTPRJ | GO:0030308 | negative regulation of cell growth | 14709717 |
Tgene | PTPRJ | GO:0030336 | negative regulation of cell migration | 16682945 |
Tgene | PTPRJ | GO:0035335 | peptidyl-tyrosine dephosphorylation | 9531590|10821867|12913111|18348712|18936167|19332538 |
Tgene | PTPRJ | GO:0043116 | negative regulation of vascular permeability | 19332538 |
Tgene | PTPRJ | GO:0043407 | negative regulation of MAP kinase activity | 19494114 |
Tgene | PTPRJ | GO:0050860 | negative regulation of T cell receptor signaling pathway | 12913111 |
Tgene | PTPRJ | GO:0050918 | positive chemotaxis | 14709717 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:64577137/chr11:48149332) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000377321 | MEN1 | chr11 | 64577137 | - | ENST00000418331 | PTPRJ | chr11 | 48149332 | + | 4190 | 513 | 68 | 3433 | 1121 |
ENST00000377321 | MEN1 | chr11 | 64577137 | - | ENST00000440289 | PTPRJ | chr11 | 48149332 | + | 2245 | 513 | 68 | 1039 | 323 |
ENST00000315422 | MEN1 | chr11 | 64577137 | - | ENST00000418331 | PTPRJ | chr11 | 48149332 | + | 4619 | 942 | 260 | 3862 | 1200 |
ENST00000315422 | MEN1 | chr11 | 64577137 | - | ENST00000440289 | PTPRJ | chr11 | 48149332 | + | 2674 | 942 | 260 | 1468 | 402 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000377321 | ENST00000418331 | MEN1 | chr11 | 64577137 | - | PTPRJ | chr11 | 48149332 | + | 0.000280637 | 0.9997193 |
ENST00000377321 | ENST00000440289 | MEN1 | chr11 | 64577137 | - | PTPRJ | chr11 | 48149332 | + | 0.000292325 | 0.99970764 |
ENST00000315422 | ENST00000418331 | MEN1 | chr11 | 64577137 | - | PTPRJ | chr11 | 48149332 | + | 0.000417233 | 0.9995828 |
ENST00000315422 | ENST00000440289 | MEN1 | chr11 | 64577137 | - | PTPRJ | chr11 | 48149332 | + | 0.000366181 | 0.9996338 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MEN1-PTPRJ |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MEN1 | chr11 | 64577137 | PTPRJ | chr11 | 48149332 | 513 | 147 | KDRAHIQSLFSFITDAIQVFDVTAVN |
MEN1 | chr11 | 64577137 | PTPRJ | chr11 | 48149332 | 942 | 226 | KDRAHIQSLFSFITDAIQVFDVTAVN |
Top |
Potential FusionNeoAntigen Information of MEN1-PTPRJ in HLA I |
![]() |
MEN1-PTPRJ_64577137_48149332.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:01 | FITDAIQVF | 0.9987 | 0.8095 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:02 | FITDAIQVF | 0.9961 | 0.8285 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:25 | FITDAIQVF | 0.9951 | 0.8175 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:08 | FITDAIQVF | 0.994 | 0.6202 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:01 | FITDAIQVF | 0.9889 | 0.7718 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:27 | SLFSFITDA | 0.9841 | 0.5086 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:13 | SLFSFITDA | 0.9822 | 0.5721 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:38 | SLFSFITDA | 0.9795 | 0.5093 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:21 | SLFSFITDA | 0.9709 | 0.6138 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B57:03 | FSFITDAIQVF | 0.9984 | 0.7839 | 9 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:16 | FSFITDAIQVF | 0.998 | 0.5409 | 9 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C05:09 | ITDAIQVF | 1 | 0.9331 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:15 | ITDAIQVF | 1 | 0.9692 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:07 | ITDAIQVF | 1 | 0.7516 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:10 | ITDAIQVF | 1 | 0.7489 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:06 | ITDAIQVF | 0.999 | 0.7699 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:14 | ITDAIQVF | 0.9981 | 0.787 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:13 | ITDAIQVF | 0.9938 | 0.9627 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:04 | ITDAIQVF | 0.9938 | 0.9627 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:03 | ITDAIQVF | 0.9734 | 0.9767 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:16 | FITDAIQVF | 0.9991 | 0.9573 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:08 | FITDAIQVF | 0.9969 | 0.7661 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:21 | FITDAIQVF | 0.9959 | 0.8286 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:12 | FITDAIQVF | 0.9944 | 0.9241 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:19 | FITDAIQVF | 0.9935 | 0.9789 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:31 | FITDAIQVF | 0.9905 | 0.74 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:05 | FITDAIQVF | 0.9895 | 0.7299 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:04 | FITDAIQVF | 0.9846 | 0.9904 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C06:03 | FITDAIQVF | 0.9836 | 0.9884 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:07 | FITDAIQVF | 0.9768 | 0.9402 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C15:04 | FITDAIQVF | 0.9616 | 0.8125 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:06 | FITDAIQVF | 0.9311 | 0.709 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:14 | FITDAIQVF | 0.918 | 0.9597 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:13 | FITDAIQVF | 0.9034 | 0.9555 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:04 | FITDAIQVF | 0.9034 | 0.9555 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:27 | FITDAIQVF | 0.8851 | 0.9333 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:10 | FITDAIQVF | 0.8795 | 0.9335 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:80 | FITDAIQVF | 0.874 | 0.914 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:67 | FITDAIQVF | 0.874 | 0.914 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:14 | FITDAIQVF | 0.8591 | 0.7278 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:03 | FITDAIQVF | 0.6985 | 0.9719 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:14 | SFITDAIQV | 0.4742 | 0.8007 | 10 | 19 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C02:06 | FITDAIQVF | 0.452 | 0.9232 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:21 | SFITDAIQVF | 0.9751 | 0.6939 | 10 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C05:01 | ITDAIQVF | 1 | 0.9331 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:02 | ITDAIQVF | 1 | 0.9692 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C18:01 | ITDAIQVF | 1 | 0.752 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:03 | ITDAIQVF | 1 | 0.7869 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:01 | ITDAIQVF | 1 | 0.7516 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B57:02 | ITDAIQVF | 0.9972 | 0.669 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:01 | ITDAIQVF | 0.9734 | 0.9767 | 12 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:02 | FITDAIQVF | 0.9994 | 0.9639 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:04 | FITDAIQVF | 0.9991 | 0.9791 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:03 | FITDAIQVF | 0.9991 | 0.9791 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:11 | FITDAIQVF | 0.9989 | 0.7649 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:02 | FITDAIQVF | 0.9988 | 0.9606 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:33 | FITDAIQVF | 0.9987 | 0.8095 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:135 | FITDAIQVF | 0.9987 | 0.7856 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:125 | FITDAIQVF | 0.9987 | 0.8095 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:27 | FITDAIQVF | 0.9987 | 0.8272 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:34 | FITDAIQVF | 0.9987 | 0.8095 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:08 | FITDAIQVF | 0.9987 | 0.7654 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:50 | FITDAIQVF | 0.9987 | 0.8604 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:67 | FITDAIQVF | 0.9986 | 0.9604 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:43 | FITDAIQVF | 0.9984 | 0.7594 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:03 | FITDAIQVF | 0.9979 | 0.9765 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:24 | FITDAIQVF | 0.9978 | 0.7795 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:12 | FITDAIQVF | 0.997 | 0.7759 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:39 | FITDAIQVF | 0.9947 | 0.7231 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:11 | FITDAIQVF | 0.9945 | 0.8219 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A25:01 | FITDAIQVF | 0.9917 | 0.8308 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:17 | FITDAIQVF | 0.991 | 0.948 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C16:04 | FITDAIQVF | 0.9909 | 0.9857 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:20 | FITDAIQVF | 0.9902 | 0.7821 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:03 | SLFSFITDA | 0.99 | 0.5946 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:77 | FITDAIQVF | 0.9889 | 0.7718 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:03 | FITDAIQVF | 0.9887 | 0.7575 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:20 | FITDAIQVF | 0.9882 | 0.7955 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C16:01 | FITDAIQVF | 0.9881 | 0.9757 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:23 | FITDAIQVF | 0.9881 | 0.7767 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:05 | FITDAIQVF | 0.988 | 0.8746 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:28 | FITDAIQVF | 0.9879 | 0.7844 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-A02:06 | SLFSFITDA | 0.9709 | 0.6138 | 7 | 16 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:17 | FITDAIQVF | 0.9701 | 0.6374 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:30 | FITDAIQVF | 0.9701 | 0.6374 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C15:09 | FITDAIQVF | 0.9616 | 0.8125 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B15:30 | FITDAIQVF | 0.9361 | 0.7576 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:06 | FITDAIQVF | 0.9279 | 0.9799 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:04 | FITDAIQVF | 0.924 | 0.6787 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-B35:24 | FITDAIQVF | 0.9177 | 0.7927 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:17 | FITDAIQVF | 0.8942 | 0.9556 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C16:02 | FITDAIQVF | 0.8836 | 0.9836 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C07:02 | FITDAIQVF | 0.874 | 0.914 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C08:01 | FITDAIQVF | 0.6985 | 0.9719 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C02:10 | FITDAIQVF | 0.5814 | 0.9508 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C02:02 | FITDAIQVF | 0.5814 | 0.9508 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C04:04 | SFITDAIQV | 0.5616 | 0.7847 | 10 | 19 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C17:01 | FITDAIQVF | 0.2553 | 0.7395 | 11 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C14:02 | SFITDAIQVF | 0.969 | 0.9218 | 10 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C14:03 | SFITDAIQVF | 0.969 | 0.9218 | 10 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C03:02 | FSFITDAIQVF | 0.9999 | 0.9428 | 9 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C12:02 | FSFITDAIQVF | 0.9997 | 0.9432 | 9 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C02:10 | FSFITDAIQVF | 0.9982 | 0.9407 | 9 | 20 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | HLA-C02:02 | FSFITDAIQVF | 0.9982 | 0.9407 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of MEN1-PTPRJ in HLA II |
![]() |
MEN1-PTPRJ_64577137_48149332.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | DRB1-0419 | QSLFSFITDAIQVFD | 6 | 21 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | DRB1-0431 | QSLFSFITDAIQVFD | 6 | 21 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | DRB1-0443 | QSLFSFITDAIQVFD | 6 | 21 |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 | DRB1-0461 | QSLFSFITDAIQVFD | 6 | 21 |
Top |
Fusion breakpoint peptide structures of MEN1-PTPRJ |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7582 | QSLFSFITDAIQVF | MEN1 | PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 942 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MEN1-PTPRJ |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7582 | QSLFSFITDAIQVF | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 7582 | QSLFSFITDAIQVF | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 7582 | QSLFSFITDAIQVF | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 7582 | QSLFSFITDAIQVF | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 7582 | QSLFSFITDAIQVF | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 7582 | QSLFSFITDAIQVF | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 7582 | QSLFSFITDAIQVF | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 7582 | QSLFSFITDAIQVF | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 7582 | QSLFSFITDAIQVF | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 7582 | QSLFSFITDAIQVF | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 7582 | QSLFSFITDAIQVF | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of MEN1-PTPRJ |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 10 | 19 | SFITDAIQV | TCATCACAGATGCTATTCAGGTTTTTG |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 10 | 20 | SFITDAIQVF | TCATCACAGATGCTATTCAGGTTTTTGACG |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 11 | 20 | FITDAIQVF | TCACAGATGCTATTCAGGTTTTTGACG |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 12 | 20 | ITDAIQVF | CAGATGCTATTCAGGTTTTTGACG |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 7 | 16 | SLFSFITDA | TCTTCAGCTTCATCACAGATGCTATTC |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 9 | 20 | FSFITDAIQVF | GCTTCATCACAGATGCTATTCAGGTTTTTGACG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MEN1-PTPRJ | chr11 | 64577137 | chr11 | 48149332 | 6 | 21 | QSLFSFITDAIQVFD | CCCTCTTCAGCTTCATCACAGATGCTATTCAGGTTTTTGACGTCA |
Top |
Information of the samples that have these potential fusion neoantigens of MEN1-PTPRJ |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
CESC | MEN1-PTPRJ | chr11 | 64577137 | ENST00000315422 | chr11 | 48149332 | ENST00000418331 | TCGA-C5-A3HD-01B |
Top |
Potential target of CAR-T therapy development for MEN1-PTPRJ |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | PTPRJ | chr11:64577137 | chr11:48149332 | ENST00000418331 | 5 | 25 | 976_996 | 0 | 1338.0 | Transmembrane | Helical | |
Tgene | PTPRJ | chr11:64577137 | chr11:48149332 | ENST00000440289 | 5 | 9 | 976_996 | 0 | 540.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MEN1-PTPRJ |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MEN1-PTPRJ |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |