Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:METTL5-TLK1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: METTL5-TLK1
	FusionPDB ID: 53137
	FusionGDB2.0 ID: 53137
		Hgene	Tgene
	Gene symbol	METTL5	TLK1
	Gene ID	29081	9874
	Gene name	methyltransferase like 5	tousled like kinase 1
	Synonyms	HSPC133\|MRT72	PKU-beta
	Cytomap	2q31.1	2q31.1
	Type of gene	protein-coding	protein-coding
	Description	methyltransferase-like protein 5	serine/threonine-protein kinase tousled-like 1SNARE protein kinase SNAKserine threonine protein kinase
	Modification date	20200327	20200329
	UniProtAcc	Q9NRN9 Main function of 5'-partner protein: FUNCTION: Catalytic subunit of a heterodimer with TRMT112, which specifically methylates the 6th position of adenine in position 1832 of 18S rRNA (PubMed:31328227, PubMed:32217665). N6-methylation of adenine(1832) in 18S rRNA is required for translation and embryonic stem cells (ESCs) pluripotency and differentiation (By similarity). {ECO:0000250\|UniProtKB:Q8K1A0, ECO:0000269\|PubMed:31328227, ECO:0000269\|PubMed:32217665}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000260953, ENST00000308099, ENST00000392640, ENST00000409340, ENST00000409837, ENST00000409965, ENST00000410097,	ENST00000486857, ENST00000360843, ENST00000431350, ENST00000434911, ENST00000442919, ENST00000521943,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 6 X 4=96	5 X 5 X 2=50
	# samples	7	6
	** MAII score	log2(7/96*10)=-0.45567948377619 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/50*10)=0.263034405833794 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: METTL5 [Title/Abstract] AND TLK1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: METTL5 [Title/Abstract] AND TLK1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	METTL5(170680998)-TLK1(171914707), # samples:1 METTL5(170680999)-TLK1(171914707), # samples:1
Anticipated loss of major functional domain due to fusion event.	METTL5-TLK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. METTL5-TLK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. METTL5-TLK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. METTL5-TLK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. METTL5-TLK1 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. METTL5-TLK1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. METTL5-TLK1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. METTL5-TLK1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TLK1	GO:0001672	regulation of chromatin assembly or disassembly	12660173
Tgene	TLK1	GO:0006468	protein phosphorylation	12660173
Tgene	TLK1	GO:0006886	intracellular protein transport	10588641
Tgene	TLK1	GO:0035556	intracellular signal transduction	12660173

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:170680998/chr2:171914707)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across METTL5 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TLK1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000409340	METTL5	chr2	170680998	-	ENST00000360843	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680998	-	ENST00000431350	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680998	-	ENST00000442919	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680998	-	ENST00000521943	TLK1	chr2	171914707	-	2353	185	76	2079	667
ENST00000409340	METTL5	chr2	170680998	-	ENST00000434911	TLK1	chr2	171914707	-	2133	185	76	2079	667
ENST00000409965	METTL5	chr2	170680998	-	ENST00000360843	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680998	-	ENST00000431350	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680998	-	ENST00000442919	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680998	-	ENST00000521943	TLK1	chr2	171914707	-	2464	296	187	2190	667
ENST00000409965	METTL5	chr2	170680998	-	ENST00000434911	TLK1	chr2	171914707	-	2244	296	187	2190	667
ENST00000410097	METTL5	chr2	170680998	-	ENST00000360843	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680998	-	ENST00000431350	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680998	-	ENST00000442919	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680998	-	ENST00000521943	TLK1	chr2	171914707	-	2413	245	136	2139	667
ENST00000410097	METTL5	chr2	170680998	-	ENST00000434911	TLK1	chr2	171914707	-	2193	245	136	2139	667
ENST00000409340	METTL5	chr2	170680999	-	ENST00000360843	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680999	-	ENST00000431350	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680999	-	ENST00000442919	TLK1	chr2	171914707	-	5037	185	76	2079	667
ENST00000409340	METTL5	chr2	170680999	-	ENST00000521943	TLK1	chr2	171914707	-	2353	185	76	2079	667
ENST00000409340	METTL5	chr2	170680999	-	ENST00000434911	TLK1	chr2	171914707	-	2133	185	76	2079	667
ENST00000409965	METTL5	chr2	170680999	-	ENST00000360843	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680999	-	ENST00000431350	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680999	-	ENST00000442919	TLK1	chr2	171914707	-	5148	296	187	2190	667
ENST00000409965	METTL5	chr2	170680999	-	ENST00000521943	TLK1	chr2	171914707	-	2464	296	187	2190	667
ENST00000409965	METTL5	chr2	170680999	-	ENST00000434911	TLK1	chr2	171914707	-	2244	296	187	2190	667
ENST00000410097	METTL5	chr2	170680999	-	ENST00000360843	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680999	-	ENST00000431350	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680999	-	ENST00000442919	TLK1	chr2	171914707	-	5097	245	136	2139	667
ENST00000410097	METTL5	chr2	170680999	-	ENST00000521943	TLK1	chr2	171914707	-	2413	245	136	2139	667
ENST00000410097	METTL5	chr2	170680999	-	ENST00000434911	TLK1	chr2	171914707	-	2193	245	136	2139	667

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000409340	ENST00000360843	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000431350	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000442919	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000521943	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000884886	0.99911505
ENST00000409340	ENST00000434911	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.001201546	0.9987985
ENST00000409965	ENST00000360843	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000431350	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000442919	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000521943	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000936413	0.99906355
ENST00000409965	ENST00000434911	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.001214596	0.99878544
ENST00000410097	ENST00000360843	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000431350	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000442919	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000521943	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.000986101	0.9990139
ENST00000410097	ENST00000434911	METTL5	chr2	170680998	-	TLK1	chr2	171914707	-	0.001283919	0.9987161
ENST00000409340	ENST00000360843	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000431350	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000442919	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000200065	0.9997999
ENST00000409340	ENST00000521943	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000884886	0.99911505
ENST00000409340	ENST00000434911	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.001201546	0.9987985
ENST00000409965	ENST00000360843	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000431350	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000442919	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.00020184	0.9997981
ENST00000409965	ENST00000521943	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000936413	0.99906355
ENST00000409965	ENST00000434911	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.001214596	0.99878544
ENST00000410097	ENST00000360843	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000431350	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000442919	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000206624	0.99979335
ENST00000410097	ENST00000521943	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.000986101	0.9990139
ENST00000410097	ENST00000434911	METTL5	chr2	170680999	-	TLK1	chr2	171914707	-	0.001283919	0.9987161

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for METTL5-TLK1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
METTL5	chr2	170680998	TLK1	chr2	171914707	185	34	PKLLLEQYPTRPHIAGKSIGGRGHKI
METTL5	chr2	170680998	TLK1	chr2	171914707	245	34	PKLLLEQYPTRPHIAGKSIGGRGHKI
METTL5	chr2	170680998	TLK1	chr2	171914707	296	34	PKLLLEQYPTRPHIAGKSIGGRGHKI
METTL5	chr2	170680999	TLK1	chr2	171914707	185	34	PKLLLEQYPTRPHIAGKSIGGRGHKI
METTL5	chr2	170680999	TLK1	chr2	171914707	245	34	PKLLLEQYPTRPHIAGKSIGGRGHKI
METTL5	chr2	170680999	TLK1	chr2	171914707	296	34	PKLLLEQYPTRPHIAGKSIGGRGHKI

Top

Potential FusionNeoAntigen Information of METTL5-TLK1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

METTL5-TLK1_170680998_171914707.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B52:01	QYPTRPHI	0.9857	0.8187	6	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B14:02	EQYPTRPHI	0.9966	0.8168	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B14:01	EQYPTRPHI	0.9966	0.8168	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B39:13	EQYPTRPHI	0.8233	0.9472	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B15:10	EQYPTRPHI	0.8095	0.6153	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B13:01	EQYPTRPHI	0.802	0.8771	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B52:01	EQYPTRPHI	0.7437	0.7877	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B15:37	EQYPTRPHI	0.6603	0.6664	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B39:06	EQYPTRPHIA	0.9695	0.8549	5	15
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B52:01	LEQYPTRPHI	0.7407	0.8962	4	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-A30:08	YPTRPHIAGK	0.624	0.5393	7	17
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-A30:08	QYPTRPHIAGK	0.9708	0.6038	6	17
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B07:12	RPHIAGKSI	0.994	0.5066	10	19
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B14:03	EQYPTRPHI	0.7538	0.8386	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B51:07	EQYPTRPHI	0.6614	0.679	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B39:10	RPHIAGKSI	0.2789	0.742	10	19
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B15:73	EQYPTRPHI	0.9603	0.8698	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-A30:01	PTRPHIAGK	0.9506	0.5631	8	17
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B15:30	EQYPTRPHI	0.9341	0.8528	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B39:02	EQYPTRPHI	0.9284	0.949	5	14
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-B67:01	RPHIAGKSI	0.3737	0.6814	10	19
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-A30:01	YPTRPHIAGK	0.6388	0.6724	7	17
METTL5-TLK1	chr2	170680998	chr2	171914707	185	HLA-A30:01	QYPTRPHIAGK	0.9741	0.7409	6	17

Top

Potential FusionNeoAntigen Information of METTL5-TLK1 in HLA II

METTL5-TLK1_170680998_171914707.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
METTL5-TLK1	chr2	170680998	chr2	171914707	185	DRB1-1457	KLLLEQYPTRPHIAG	1	16

Top

Fusion breakpoint peptide structures of METTL5-TLK1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7653	QYPTRPHIAGKSIG	METTL5	TLK1	chr2	170680998	chr2	171914707	185

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of METTL5-TLK1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7653	QYPTRPHIAGKSIG	-7.15543	-7.26883
HLA-B14:02	3BVN	7653	QYPTRPHIAGKSIG	-4.77435	-5.80965
HLA-B52:01	3W39	7653	QYPTRPHIAGKSIG	-6.80875	-6.92215
HLA-B52:01	3W39	7653	QYPTRPHIAGKSIG	-4.20386	-5.23916
HLA-A11:01	4UQ2	7653	QYPTRPHIAGKSIG	-7.5194	-8.5547
HLA-A11:01	4UQ2	7653	QYPTRPHIAGKSIG	-6.9601	-7.0735
HLA-A24:02	5HGA	7653	QYPTRPHIAGKSIG	-7.52403	-7.63743
HLA-A24:02	5HGA	7653	QYPTRPHIAGKSIG	-5.82433	-6.85963
HLA-B27:05	6PYJ	7653	QYPTRPHIAGKSIG	-3.28285	-4.31815
HLA-B44:05	3DX8	7653	QYPTRPHIAGKSIG	-5.91172	-6.94702
HLA-B44:05	3DX8	7653	QYPTRPHIAGKSIG	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of METTL5-TLK1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
METTL5-TLK1	chr2	170680998	chr2	171914707	10	19	RPHIAGKSI	ACATTGCAGGAAAAAGTATTGGGGGAC
METTL5-TLK1	chr2	170680998	chr2	171914707	4	14	LEQYPTRPHI	AGTATCCTACCAGGCCGCACATTGCAGGAA
METTL5-TLK1	chr2	170680998	chr2	171914707	5	14	EQYPTRPHI	ATCCTACCAGGCCGCACATTGCAGGAA
METTL5-TLK1	chr2	170680998	chr2	171914707	5	15	EQYPTRPHIA	ATCCTACCAGGCCGCACATTGCAGGAAAAA
METTL5-TLK1	chr2	170680998	chr2	171914707	6	14	QYPTRPHI	CTACCAGGCCGCACATTGCAGGAA
METTL5-TLK1	chr2	170680998	chr2	171914707	6	17	QYPTRPHIAGK	CTACCAGGCCGCACATTGCAGGAAAAAGTATTG
METTL5-TLK1	chr2	170680998	chr2	171914707	7	17	YPTRPHIAGK	CCAGGCCGCACATTGCAGGAAAAAGTATTG
METTL5-TLK1	chr2	170680998	chr2	171914707	8	17	PTRPHIAGK	GGCCGCACATTGCAGGAAAAAGTATTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
METTL5-TLK1	chr2	170680998	chr2	171914707	1	16	KLLLEQYPTRPHIAG	TTCTGGAACAGTATCCTACCAGGCCGCACATTGCAGGAAAAAGTA

Top

Information of the samples that have these potential fusion neoantigens of METTL5-TLK1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	METTL5-TLK1	chr2	170680998	ENST00000409340	chr2	171914707	ENST00000360843	TCGA-CG-4449

Top

Potential target of CAR-T therapy development for METTL5-TLK1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to METTL5-TLK1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to METTL5-TLK1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)