Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MGA-ANKLE1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MGA-ANKLE1
	FusionPDB ID: 53291
	FusionGDB2.0 ID: 53291
		Hgene	Tgene
	Gene symbol	MGA	ANKLE1
	Gene ID	23269	126549
	Gene name	MAX dimerization protein MGA	ankyrin repeat and LEM domain containing 1
	Synonyms	MAD5\|MXD5	ANKRD41\|LEM3\|LEMD6
	Cytomap	15q15.1	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	MAX gene-associated proteinMAX dimerization protein 5MGA, MAX dimerization protein	ankyrin repeat and LEM domain-containing protein 1LEM domain containing 6LEM-domain containing 3ankyrin repeat domain-containing protein 41
	Modification date	20200313	20200320
	UniProtAcc	Q3V5L5 Main function of 5'-partner protein: FUNCTION: Glycosyltransferase that acts on alpha-linked mannose of N-glycans and O-mannosyl glycans. Catalyzes the transfer of N-acetylglucosamine (GlcNAc) to the beta 1-6 linkage of the mannose residue of GlcNAc-beta1,2-Man-alpha on both the alpha1,3- and alpha1,6-linked mannose arms in the core structure of N-glycan. Also acts on the GlcNAc-beta1,2-Man-alpha1-Ser/Thr moiety, forming a 2,6-branched structure in brain O-mannosyl glycan. Plays an active role in modulating integrin and laminin-dependent adhesion and migration of neuronal cells via its activity in the O-mannosyl glycan pathway. {ECO:0000269\|PubMed:12941944, ECO:0000269\|PubMed:14617637, ECO:0000269\|PubMed:14623122, ECO:0000269\|PubMed:16606368, ECO:0000269\|PubMed:16857188, ECO:0000269\|PubMed:19846580}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000219905, ENST00000389936, ENST00000545763, ENST00000566586, ENST00000570161, ENST00000568630,	ENST00000433424, ENST00000394458, ENST00000404085, ENST00000594072, ENST00000598347,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 14 X 11=2618	2 X 2 X 2=8
	# samples	18	2
	** MAII score	log2(18/2618*10)=-3.86239628561557 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/8*10)=1.32192809488736
Fusion gene context	PubMed: MGA [Title/Abstract] AND ANKLE1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MGA [Title/Abstract] AND ANKLE1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MGA(41962156)-ANKLE1(17396240), # samples:1
Anticipated loss of major functional domain due to fusion event.	MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. MGA-ANKLE1 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. MGA-ANKLE1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ANKLE1	GO:0006611	protein export from nucleus	22399800
Tgene	ANKLE1	GO:2001022	positive regulation of response to DNA damage stimulus	22399800

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:41962156/chr19:17396240)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MGA (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ANKLE1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000545763	MGA	chr15	41962156	-	ENST00000394458	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000545763	MGA	chr15	41962156	-	ENST00000404085	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000545763	MGA	chr15	41962156	-	ENST00000594072	ANKLE1	chr19	17396240	+	2019	1245	181	1716	511
ENST00000545763	MGA	chr15	41962156	-	ENST00000598347	ANKLE1	chr19	17396240	+	1948	1245	181	1740	519
ENST00000389936	MGA	chr15	41962156	-	ENST00000394458	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000389936	MGA	chr15	41962156	-	ENST00000404085	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000389936	MGA	chr15	41962156	-	ENST00000594072	ANKLE1	chr19	17396240	+	2019	1245	181	1716	511
ENST00000389936	MGA	chr15	41962156	-	ENST00000598347	ANKLE1	chr19	17396240	+	1948	1245	181	1740	519
ENST00000219905	MGA	chr15	41962156	-	ENST00000394458	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000219905	MGA	chr15	41962156	-	ENST00000404085	ANKLE1	chr19	17396240	+	2811	1245	181	1716	511
ENST00000219905	MGA	chr15	41962156	-	ENST00000594072	ANKLE1	chr19	17396240	+	2019	1245	181	1716	511
ENST00000219905	MGA	chr15	41962156	-	ENST00000598347	ANKLE1	chr19	17396240	+	1948	1245	181	1740	519
ENST00000566586	MGA	chr15	41962156	-	ENST00000394458	ANKLE1	chr19	17396240	+	2697	1131	67	1602	511
ENST00000566586	MGA	chr15	41962156	-	ENST00000404085	ANKLE1	chr19	17396240	+	2697	1131	67	1602	511
ENST00000566586	MGA	chr15	41962156	-	ENST00000594072	ANKLE1	chr19	17396240	+	1905	1131	67	1602	511
ENST00000566586	MGA	chr15	41962156	-	ENST00000598347	ANKLE1	chr19	17396240	+	1834	1131	67	1626	519
ENST00000570161	MGA	chr15	41962156	-	ENST00000394458	ANKLE1	chr19	17396240	+	2630	1064	0	1535	511
ENST00000570161	MGA	chr15	41962156	-	ENST00000404085	ANKLE1	chr19	17396240	+	2630	1064	0	1535	511
ENST00000570161	MGA	chr15	41962156	-	ENST00000594072	ANKLE1	chr19	17396240	+	1838	1064	0	1535	511
ENST00000570161	MGA	chr15	41962156	-	ENST00000598347	ANKLE1	chr19	17396240	+	1767	1064	0	1559	519

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000545763	ENST00000394458	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000545763	ENST00000404085	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000545763	ENST00000594072	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000283176	0.9997168
ENST00000545763	ENST00000598347	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.0009278	0.9990722
ENST00000389936	ENST00000394458	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000389936	ENST00000404085	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000389936	ENST00000594072	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000283176	0.9997168
ENST00000389936	ENST00000598347	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.0009278	0.9990722
ENST00000219905	ENST00000394458	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000219905	ENST00000404085	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.00037192	0.99962807
ENST00000219905	ENST00000594072	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000283176	0.9997168
ENST00000219905	ENST00000598347	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.0009278	0.9990722
ENST00000566586	ENST00000394458	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000349105	0.99965084
ENST00000566586	ENST00000404085	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000349105	0.99965084
ENST00000566586	ENST00000594072	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000253309	0.99974674
ENST00000566586	ENST00000598347	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000792955	0.9992071
ENST00000570161	ENST00000394458	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000395078	0.999605
ENST00000570161	ENST00000404085	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000395078	0.999605
ENST00000570161	ENST00000594072	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000295414	0.99970454
ENST00000570161	ENST00000598347	MGA	chr15	41962156	-	ANKLE1	chr19	17396240	+	0.000939725	0.99906033

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MGA-ANKLE1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MGA	chr15	41962156	ANKLE1	chr19	17396240	1064	355	SEVPQLKQEISEWETQDLPARAFSLT
MGA	chr15	41962156	ANKLE1	chr19	17396240	1131	355	SEVPQLKQEISEWETQDLPARAFSLT
MGA	chr15	41962156	ANKLE1	chr19	17396240	1245	355	SEVPQLKQEISEWETQDLPARAFSLT

Top

Potential FusionNeoAntigen Information of MGA-ANKLE1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MGA-ANKLE1_41962156_17396240.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B18:01	SEWETQDL	0.9431	0.9352	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B39:13	SEWETQDL	0.9308	0.9011	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B45:01	SEWETQDLP	0.9848	0.8485	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:02	SEWETQDLP	0.9757	0.6816	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B41:01	SEWETQDLP	0.3773	0.8313	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:01	SEWETQDLP	0.3128	0.7725	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B45:01	SEWETQDLPA	0.9938	0.9572	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:02	SEWETQDLPA	0.9907	0.7871	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:01	SEWETQDLPA	0.909	0.8127	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B41:01	SEWETQDLPA	0.8669	0.9544	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B44:05	WETQDLPARAF	0.9943	0.9384	12	23
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B39:08	SEWETQDL	0.9876	0.8766	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-C05:09	ISEWETQDL	0.9999	0.9581	9	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-C08:15	ISEWETQDL	0.9998	0.9745	9	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B40:06	SEWETQDLP	0.9727	0.7555	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B40:06	SEWETQDLPA	0.9949	0.8917	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B40:04	SEWETQDL	0.9998	0.7003	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B18:11	SEWETQDL	0.9602	0.893	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B18:05	SEWETQDL	0.9431	0.9352	10	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-C05:01	ISEWETQDL	0.9999	0.9581	9	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-C08:02	ISEWETQDL	0.9998	0.9745	9	18
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:04	SEWETQDLP	0.3128	0.7725	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:05	SEWETQDLP	0.3128	0.7725	10	19
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:04	SEWETQDLPA	0.909	0.8127	10	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	HLA-B50:05	SEWETQDLPA	0.909	0.8127	10	20

Top

Potential FusionNeoAntigen Information of MGA-ANKLE1 in HLA II

MGA-ANKLE1_41962156_17396240.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1457	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1501	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1503	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1504	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1505	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1506	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1507	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1509	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1510	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1512	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1512	LKQEISEWETQDLPA	5	20
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1513	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1516	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1520	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1522	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1523	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1524	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1528	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1532	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1533	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1535	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1536	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1537	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1540	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1541	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1542	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1543	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1545	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1546	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1548	KQEISEWETQDLPAR	6	21
MGA-ANKLE1	chr15	41962156	chr19	17396240	1245	DRB1-1549	KQEISEWETQDLPAR	6	21

Top

Fusion breakpoint peptide structures of MGA-ANKLE1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4515	KQEISEWETQDLPA	MGA	ANKLE1	chr15	41962156	chr19	17396240	1245

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MGA-ANKLE1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4515	KQEISEWETQDLPA	-7.9962	-8.1096
HLA-B14:02	3BVN	4515	KQEISEWETQDLPA	-5.70842	-6.74372
HLA-B52:01	3W39	4515	KQEISEWETQDLPA	-6.83737	-6.95077
HLA-B52:01	3W39	4515	KQEISEWETQDLPA	-4.4836	-5.5189
HLA-A11:01	4UQ2	4515	KQEISEWETQDLPA	-10.0067	-10.1201
HLA-A11:01	4UQ2	4515	KQEISEWETQDLPA	-9.03915	-10.0745
HLA-A24:02	5HGA	4515	KQEISEWETQDLPA	-6.56204	-6.67544
HLA-A24:02	5HGA	4515	KQEISEWETQDLPA	-5.42271	-6.45801
HLA-B44:05	3DX8	4515	KQEISEWETQDLPA	-7.85648	-8.89178
HLA-B44:05	3DX8	4515	KQEISEWETQDLPA	-5.3978	-5.5112
HLA-A02:01	6TDR	4515	KQEISEWETQDLPA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of MGA-ANKLE1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MGA-ANKLE1	chr15	41962156	chr19	17396240	10	18	SEWETQDL	TTCTGAATGGGAGACTCAGGACCT
MGA-ANKLE1	chr15	41962156	chr19	17396240	10	19	SEWETQDLP	TTCTGAATGGGAGACTCAGGACCTGCC
MGA-ANKLE1	chr15	41962156	chr19	17396240	10	20	SEWETQDLPA	TTCTGAATGGGAGACTCAGGACCTGCCAGC
MGA-ANKLE1	chr15	41962156	chr19	17396240	12	23	WETQDLPARAF	ATGGGAGACTCAGGACCTGCCAGCCCGAGCCTT
MGA-ANKLE1	chr15	41962156	chr19	17396240	9	18	ISEWETQDL	GATTTCTGAATGGGAGACTCAGGACCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MGA-ANKLE1	chr15	41962156	chr19	17396240	5	20	LKQEISEWETQDLPA	ATTGAAGCAAGAGATTTCTGAATGGGAGACTCAGGACCTGCCAGC
MGA-ANKLE1	chr15	41962156	chr19	17396240	6	21	KQEISEWETQDLPAR	GAAGCAAGAGATTTCTGAATGGGAGACTCAGGACCTGCCAGCCCG

Top

Information of the samples that have these potential fusion neoantigens of MGA-ANKLE1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	MGA-ANKLE1	chr15	41962156	ENST00000219905	chr19	17396240	ENST00000394458	TCGA-67-3773-01A

Top

Potential target of CAR-T therapy development for MGA-ANKLE1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MGA-ANKLE1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MGA-ANKLE1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)