![]() |
|||||||
|
Fusion Protein:MINK1-PELP1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MINK1-PELP1 | FusionPDB ID: 53690 | FusionGDB2.0 ID: 53690 | Hgene | Tgene | Gene symbol | MINK1 | PELP1 | Gene ID | 50488 | 27043 |
Gene name | misshapen like kinase 1 | proline, glutamate and leucine rich protein 1 | |
Synonyms | B55|MAP4K6|MINK|YSK2|ZC3 | MNAR|P160 | |
Cytomap | 17p13.2 | 17p13.2 | |
Type of gene | protein-coding | protein-coding | |
Description | misshapen-like kinase 1GCK family kinase MINKMAPK/ERK kinase kinase kinase 6MEK kinase kinase 6MEKKK 6misshapen/NIK-related kinasemitogen-activated protein kinase kinase kinase kinase 6 | proline-, glutamic acid- and leucine-rich protein 1modulator of non-genomic activity of estrogen receptorproline and glutamic acid rich nuclear proteintranscription factor HMX3 | |
Modification date | 20200320 | 20200329 | |
UniProtAcc | Q8N4C8 Main function of 5'-partner protein: FUNCTION: Serine/threonine kinase which acts as a negative regulator of Ras-related Rap2-mediated signal transduction to control neuronal structure and AMPA receptor trafficking. Required for normal synaptic density, dendrite complexity, as well as surface AMPA receptor expression in hippocampal neurons. Can activate the JNK and MAPK14/p38 pathways and mediates stimulation of the stress-activated protein kinase MAPK14/p38 MAPK downstream of the Raf/ERK pathway. Phosphorylates: TANC1 upon stimulation by RAP2A, MBP and SMAD1. Has an essential function in negative selection of thymocytes, perhaps by coupling NCK1 to activation of JNK1.; FUNCTION: Isoform 4 can activate the JNK pathway. Involved in the regulation of actin cytoskeleton reorganization, cell-matrix adhesion, cell-cell adhesion and cell migration. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000347992, ENST00000355280, ENST00000453408, | ENST00000436683, ENST00000570823, ENST00000269230, ENST00000301396, ENST00000572293, ENST00000574876, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 8 X 5=520 | 7 X 5 X 7=245 |
# samples | 17 | 13 | |
** MAII score | log2(17/520*10)=-1.61297687689075 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(13/245*10)=-0.914270125974116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MINK1 [Title/Abstract] AND PELP1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MINK1 [Title/Abstract] AND PELP1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MINK1(4736935)-PELP1(4586247), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | MINK1-PELP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MINK1-PELP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MINK1-PELP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MINK1-PELP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MINK1 | GO:0046777 | protein autophosphorylation | 15469942 |
Tgene | PELP1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 17505058 |
Tgene | PELP1 | GO:0071391 | cellular response to estrogen stimulus | 17505058 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:4736935/chr17:4586247) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000355280 | MINK1 | chr17 | 4736935 | + | ENST00000574876 | PELP1 | chr17 | 4586247 | - | 3281 | 253 | 196 | 3225 | 1009 |
ENST00000355280 | MINK1 | chr17 | 4736935 | + | ENST00000572293 | PELP1 | chr17 | 4586247 | - | 3280 | 253 | 196 | 3225 | 1009 |
ENST00000355280 | MINK1 | chr17 | 4736935 | + | ENST00000269230 | PELP1 | chr17 | 4586247 | - | 3010 | 253 | 196 | 2955 | 919 |
ENST00000355280 | MINK1 | chr17 | 4736935 | + | ENST00000301396 | PELP1 | chr17 | 4586247 | - | 3712 | 253 | 196 | 3657 | 1153 |
ENST00000347992 | MINK1 | chr17 | 4736935 | + | ENST00000574876 | PELP1 | chr17 | 4586247 | - | 3269 | 241 | 184 | 3213 | 1009 |
ENST00000347992 | MINK1 | chr17 | 4736935 | + | ENST00000572293 | PELP1 | chr17 | 4586247 | - | 3268 | 241 | 184 | 3213 | 1009 |
ENST00000347992 | MINK1 | chr17 | 4736935 | + | ENST00000269230 | PELP1 | chr17 | 4586247 | - | 2998 | 241 | 184 | 2943 | 919 |
ENST00000347992 | MINK1 | chr17 | 4736935 | + | ENST00000301396 | PELP1 | chr17 | 4586247 | - | 3700 | 241 | 184 | 3645 | 1153 |
ENST00000453408 | MINK1 | chr17 | 4736935 | + | ENST00000574876 | PELP1 | chr17 | 4586247 | - | 3085 | 57 | 0 | 3029 | 1009 |
ENST00000453408 | MINK1 | chr17 | 4736935 | + | ENST00000572293 | PELP1 | chr17 | 4586247 | - | 3084 | 57 | 0 | 3029 | 1009 |
ENST00000453408 | MINK1 | chr17 | 4736935 | + | ENST00000269230 | PELP1 | chr17 | 4586247 | - | 2814 | 57 | 0 | 2759 | 919 |
ENST00000453408 | MINK1 | chr17 | 4736935 | + | ENST00000301396 | PELP1 | chr17 | 4586247 | - | 3516 | 57 | 0 | 3461 | 1153 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000355280 | ENST00000574876 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.006909051 | 0.99309087 |
ENST00000355280 | ENST00000572293 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.006873051 | 0.993127 |
ENST00000355280 | ENST00000269230 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.008034005 | 0.991966 |
ENST00000355280 | ENST00000301396 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.003833615 | 0.99616647 |
ENST00000347992 | ENST00000574876 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.006687046 | 0.9933129 |
ENST00000347992 | ENST00000572293 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.00665159 | 0.9933484 |
ENST00000347992 | ENST00000269230 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.007895427 | 0.99210453 |
ENST00000347992 | ENST00000301396 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.003730489 | 0.99626946 |
ENST00000453408 | ENST00000574876 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.006028269 | 0.99397177 |
ENST00000453408 | ENST00000572293 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.00599973 | 0.9940003 |
ENST00000453408 | ENST00000269230 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.008209601 | 0.9917904 |
ENST00000453408 | ENST00000301396 | MINK1 | chr17 | 4736935 | + | PELP1 | chr17 | 4586247 | - | 0.003190179 | 0.9968098 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MINK1-PELP1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 241 | 17 | APARSLDDIDLSALRTQDPPATMELA |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 241 | 548 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 241 | 692 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 253 | 17 | APARSLDDIDLSALRTQDPPATMELA |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 253 | 548 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 253 | 692 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 57 | 17 | APARSLDDIDLSALRTQDPPATMELA |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 57 | 548 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
MINK1 | chr17 | 4736935 | PELP1 | chr17 | 4586247 | 57 | 692 | PSPFRAPPFHPPGPMPSVGSMPSAGP |
Top |
Potential FusionNeoAntigen Information of MINK1-PELP1 in HLA I |
![]() |
MINK1-PELP1_4736935_4586247.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MINK1-PELP1 | chr17 | 4736935 | chr17 | 4586247 | 241 | HLA-B15:73 | ALRTQDPPATM | 0.9971 | 0.9962 | 12 | 23 |
MINK1-PELP1 | chr17 | 4736935 | chr17 | 4586247 | 241 | HLA-B15:30 | ALRTQDPPATM | 0.9948 | 0.9953 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of MINK1-PELP1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of MINK1-PELP1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1029 | DDIDLSALRTQDPP | MINK1 | PELP1 | chr17 | 4736935 | chr17 | 4586247 | 241 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MINK1-PELP1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1029 | DDIDLSALRTQDPP | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 1029 | DDIDLSALRTQDPP | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 1029 | DDIDLSALRTQDPP | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 1029 | DDIDLSALRTQDPP | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 1029 | DDIDLSALRTQDPP | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 1029 | DDIDLSALRTQDPP | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 1029 | DDIDLSALRTQDPP | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 1029 | DDIDLSALRTQDPP | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 1029 | DDIDLSALRTQDPP | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 1029 | DDIDLSALRTQDPP | -5.3978 | -5.5112 |
HLA-B35:01 | 1A1N | 1029 | DDIDLSALRTQDPP | -6.27422 | -6.38762 |
HLA-B35:01 | 1A1N | 1029 | DDIDLSALRTQDPP | -5.27424 | -6.30954 |
HLA-A02:01 | 6TDR | 1029 | DDIDLSALRTQDPP | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of MINK1-PELP1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MINK1-PELP1 | chr17 | 4736935 | chr17 | 4586247 | 12 | 23 | ALRTQDPPATM | CGGACCCAGGACCCGCCTGCCACAATGGAGCTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of MINK1-PELP1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | MINK1-PELP1 | chr17 | 4736935 | ENST00000347992 | chr17 | 4586247 | ENST00000269230 | TCGA-HU-A4GN-01A |
Top |
Potential target of CAR-T therapy development for MINK1-PELP1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MINK1-PELP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MINK1-PELP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |