Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MKS1-KSR1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MKS1-KSR1
	FusionPDB ID: 54132
	FusionGDB2.0 ID: 54132
		Hgene	Tgene
	Gene symbol	MKS1	KSR1
	Gene ID	54903	8844
	Gene name	MKS transition zone complex subunit 1	kinase suppressor of ras 1
	Synonyms	BBS13\|JBTS28\|MES\|MKS\|POC12	KSR\|RSU2
	Cytomap	17q22	17q11.2
	Type of gene	protein-coding	protein-coding
	Description	Meckel syndrome type 1 proteinPOC12 centriolar protein homolog	kinase suppressor of Ras 1
	Modification date	20200313	20200327
	UniProtAcc	Q9NXB0 Main function of 5'-partner protein: FUNCTION: Component of the tectonic-like complex, a complex localized at the transition zone of primary cilia and acting as a barrier that prevents diffusion of transmembrane proteins between the cilia and plasma membranes. Involved in centrosome migration to the apical cell surface during early ciliogenesis. Required for ciliary structure and function, including a role in regulating length and appropriate number through modulating centrosome duplication. Required for cell branching morphology. {ECO:0000269\|PubMed:17185389, ECO:0000269\|PubMed:19515853, ECO:0000269\|PubMed:26490104}.	Q8IVT5 Main function of 5'-partner protein: FUNCTION: Part of a multiprotein signaling complex which promotes phosphorylation of Raf family members and activation of downstream MAP kinases (By similarity). Independently of its kinase activity, acts as MAP2K1/MEK1 and MAP2K2/MEK2-dependent allosteric activator of BRAF; upon binding to MAP2K1/MEK1 or MAP2K2/MEK2, dimerizes with BRAF and promotes BRAF-mediated phosphorylation of MAP2K1/MEK1 and/or MAP2K2/MEK2 (PubMed:29433126). Promotes activation of MAPK1 and/or MAPK3, both in response to EGF and to cAMP (By similarity). Its kinase activity is unsure (By similarity). Some protein kinase activity has been detected in vitro, however the physiological relevance of this activity is unknown (By similarity). {ECO:0000250\|UniProtKB:Q61097, ECO:0000269\|PubMed:29433126}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000313863, ENST00000337050, ENST00000393119, ENST00000537529, ENST00000546108,	ENST00000268763, ENST00000398988, ENST00000578981, ENST00000581975, ENST00000582410, ENST00000319524, ENST00000509603,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 4 X 1=12	13 X 9 X 7=819
	# samples	3	12
	** MAII score	log2(3/12*10)=1.32192809488736 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(12/819*10)=-2.77082904603249 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MKS1 [Title/Abstract] AND KSR1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MKS1 [Title/Abstract] AND KSR1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MKS1(56294027)-KSR1(25904518), # samples:1 MKS1(56293449)-KSR1(25909672), # samples:1
Anticipated loss of major functional domain due to fusion event.	MKS1-KSR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MKS1-KSR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MKS1-KSR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MKS1-KSR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MKS1-KSR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. MKS1-KSR1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. MKS1-KSR1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	KSR1	GO:0000185	activation of MAPKKK activity	29433126

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:56294027/chr17:25904518)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MKS1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across KSR1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000393119	MKS1	chr17	56294027	-	ENST00000509603	KSR1	chr17	25904518	+	2595	336	75	2594	840
ENST00000393119	MKS1	chr17	56294027	-	ENST00000319524	KSR1	chr17	25904518	+	3035	336	75	2735	886
ENST00000337050	MKS1	chr17	56294027	-	ENST00000509603	KSR1	chr17	25904518	+	2530	271	10	2529	840
ENST00000337050	MKS1	chr17	56294027	-	ENST00000319524	KSR1	chr17	25904518	+	2970	271	10	2670	886
ENST00000537529	MKS1	chr17	56294027	-	ENST00000509603	KSR1	chr17	25904518	+	2584	325	91	2583	831
ENST00000537529	MKS1	chr17	56294027	-	ENST00000319524	KSR1	chr17	25904518	+	3024	325	91	2724	877

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000393119	ENST00000509603	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.5409922	0.45900783
ENST00000393119	ENST00000319524	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.015936432	0.9840636
ENST00000337050	ENST00000509603	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.48486146	0.5151385
ENST00000337050	ENST00000319524	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.017363634	0.98263633
ENST00000537529	ENST00000509603	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.7211299	0.2788701
ENST00000537529	ENST00000319524	MKS1	chr17	56294027	-	KSR1	chr17	25904518	+	0.022634717	0.9773653

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MKS1-KSR1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MKS1	chr17	56294027	KSR1	chr17	25904518	271	87	EIVIGWQEKLFSQEIPRDLTLDALLE
MKS1	chr17	56294027	KSR1	chr17	25904518	325	78	EIVIGWQEKLFSQEIPRDLTLDALLE
MKS1	chr17	56294027	KSR1	chr17	25904518	336	87	EIVIGWQEKLFSQEIPRDLTLDALLE

Top

Potential FusionNeoAntigen Information of MKS1-KSR1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MKS1-KSR1_56294027_25904518.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:02	QEKLFSQEI	0.9972	0.561	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-A74:11	KLFSQEIPR	0.9965	0.5235	8	17
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-A74:09	KLFSQEIPR	0.9965	0.5235	8	17
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-A74:03	KLFSQEIPR	0.9965	0.5235	8	17
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:03	QEIPRDLTL	0.9937	0.9705	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:02	QEIPRDLTL	0.9935	0.6209	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B45:01	QEKLFSQEI	0.9925	0.8652	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:03	QEKLFSQEI	0.9924	0.937	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B14:01	QEIPRDLTL	0.9917	0.7911	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B14:02	QEIPRDLTL	0.9917	0.7911	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B13:01	QEIPRDLTL	0.9909	0.9567	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B45:01	QEIPRDLTL	0.9672	0.9123	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:24	QEIPRDLTL	0.9661	0.6155	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B47:01	QEIPRDLTL	0.9646	0.7364	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:01	QEIPRDLTL	0.8879	0.9637	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:01	QEKLFSQEI	0.8871	0.9433	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:01	QEIPRDLTL	0.8739	0.9669	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:13	QEIPRDLTL	0.8638	0.9745	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B38:01	QEIPRDLTL	0.8484	0.9786	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B38:02	QEIPRDLTL	0.8473	0.9834	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:01	QEKLFSQEI	0.7339	0.8915	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:10	QEIPRDLTL	0.6671	0.8179	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:01	QEKLFSQEI	0.6232	0.6019	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:37	QEIPRDLTL	0.6081	0.7247	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:13	QEKLFSQEI	0.5962	0.8883	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:01	QEIPRDLTL	0.5868	0.9452	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:01	QEIPRDLTL	0.5499	0.7594	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B52:01	QEKLFSQEI	0.5196	0.7741	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B52:01	QEIPRDLTL	0.2235	0.8589	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B45:01	QEKLFSQEIP	0.9904	0.9354	6	16
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:13	SQEIPRDLTL	0.9308	0.9638	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B47:01	SQEIPRDLTL	0.8363	0.5939	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B13:01	SQEIPRDLTL	0.7929	0.9315	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:03	SQEIPRDLTL	0.705	0.9524	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B45:01	QEIPRDLTLDA	0.9958	0.9935	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:02	QEIPRDLTLDA	0.9866	0.7986	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:01	QEIPRDLTLDA	0.9718	0.9758	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:01	QEIPRDLTLDA	0.9716	0.8291	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:06	QEKLFSQEI	0.9997	0.5497	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:08	FSQEIPRDL	0.9995	0.9215	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:19	FSQEIPRDL	0.9995	0.9891	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:07	FSQEIPRDL	0.9995	0.9729	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:06	QEIPRDLTL	0.9993	0.7316	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:04	FSQEIPRDL	0.9993	0.8741	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:06	FSQEIPRDL	0.9992	0.9026	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C04:06	FSQEIPRDL	0.9976	0.8903	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C01:17	FSQEIPRDL	0.9947	0.928	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C08:13	FSQEIPRDL	0.9935	0.9454	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C08:04	FSQEIPRDL	0.9935	0.9454	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C06:03	FSQEIPRDL	0.9884	0.99	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C12:04	FSQEIPRDL	0.9871	0.9904	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C12:12	FSQEIPRDL	0.9808	0.9108	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C08:03	FSQEIPRDL	0.9653	0.9787	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:03	QEIPRDLTL	0.9609	0.5345	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:14	FSQEIPRDL	0.9468	0.9812	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C12:16	FSQEIPRDL	0.9006	0.9526	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C07:13	FSQEIPRDL	0.8987	0.9371	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:09	QEIPRDLTL	0.8965	0.8136	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C07:29	FSQEIPRDL	0.8679	0.9552	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B14:03	QEIPRDLTL	0.8661	0.8866	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C01:30	FSQEIPRDL	0.8462	0.9355	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:12	QEIPRDLTL	0.8441	0.9686	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:05	QEIPRDLTL	0.8426	0.9637	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:08	QEIPRDLTL	0.8354	0.9506	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C07:95	FSQEIPRDL	0.7828	0.7797	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:08	QEKLFSQEI	0.722	0.8202	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C02:06	FSQEIPRDL	0.6968	0.9566	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B51:07	QEKLFSQEI	0.4834	0.7303	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B51:07	QEIPRDLTL	0.1234	0.767	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:03	SQEIPRDLTL	0.9556	0.5148	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:08	SQEIPRDLTL	0.9409	0.9519	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:07	FSQEIPRDLTL	1	0.9788	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:19	FSQEIPRDLTL	1	0.9919	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:08	FSQEIPRDLTL	1	0.9375	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:06	FSQEIPRDLTL	0.9999	0.9056	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:06	QEIPRDLTLDA	0.9716	0.9388	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:03	FSQEIPRDL	0.9996	0.9901	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:04	FSQEIPRDL	0.9996	0.9901	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:09	FSQEIPRDL	0.9993	0.8741	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:05	FSQEIPRDL	0.9991	0.9067	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:05	FSQEIPRDL	0.999	0.9292	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:17	FSQEIPRDL	0.999	0.9652	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:02	FSQEIPRDL	0.9988	0.8696	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:02	FSQEIPRDL	0.9986	0.9698	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:67	FSQEIPRDL	0.9984	0.9788	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:04	QEIPRDLTL	0.9984	0.7793	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:04	QEKLFSQEI	0.9981	0.6581	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-A74:01	KLFSQEIPR	0.9965	0.5235	8	17
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C06:06	FSQEIPRDL	0.9961	0.9853	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C16:04	FSQEIPRDL	0.9942	0.9743	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:07	QEIPRDLTL	0.9937	0.9705	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:26	QEIPRDLTL	0.9937	0.9705	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:13	QEIPRDLTL	0.9937	0.9705	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:26	QEKLFSQEI	0.9924	0.937	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:07	QEKLFSQEI	0.9924	0.937	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:13	QEKLFSQEI	0.9924	0.937	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C12:03	FSQEIPRDL	0.9894	0.9711	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:06	FSQEIPRDL	0.9878	0.9904	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:03	QEKLFSQEI	0.9741	0.6779	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C06:17	FSQEIPRDL	0.9717	0.9897	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C06:02	FSQEIPRDL	0.9717	0.9897	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C08:01	FSQEIPRDL	0.9653	0.9787	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C12:02	FSQEIPRDL	0.9467	0.9617	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C07:04	FSQEIPRDL	0.9451	0.9537	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C16:02	FSQEIPRDL	0.927	0.9899	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:04	QEIPRDLTL	0.9232	0.9685	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:07	QEIPRDLTL	0.9082	0.9456	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C16:01	FSQEIPRDL	0.9077	0.9714	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:08	QEIPRDLTL	0.8942	0.9543	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:02	QEIPRDLTL	0.8936	0.9753	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:11	QEIPRDLTL	0.8925	0.9694	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:05	QEIPRDLTL	0.8879	0.9637	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:31	QEIPRDLTL	0.8854	0.9666	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C07:22	FSQEIPRDL	0.885	0.7847	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:11	QEKLFSQEI	0.8505	0.8833	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B38:05	QEIPRDLTL	0.8484	0.9786	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:06	QEIPRDLTL	0.8423	0.969	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:03	QEIPRDLTL	0.8411	0.9591	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:11	QEIPRDLTL	0.8139	0.9141	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:08	QEKLFSQEI	0.7736	0.7861	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:03	QEIPRDLTL	0.7681	0.7941	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:06	QEKLFSQEI	0.7557	0.8878	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:05	QEKLFSQEI	0.7339	0.8915	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B18:03	QEKLFSQEI	0.7324	0.883	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C02:02	FSQEIPRDL	0.6903	0.9734	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C02:10	FSQEIPRDL	0.6903	0.9734	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B48:02	QEIPRDLTL	0.6553	0.9798	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:02	QEKLFSQEI	0.6238	0.8905	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:05	QEKLFSQEI	0.6232	0.6019	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:04	QEKLFSQEI	0.6232	0.6019	6	15
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:04	QEIPRDLTL	0.5499	0.7594	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:05	QEIPRDLTL	0.5499	0.7594	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C17:01	FSQEIPRDL	0.5446	0.6381	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C06:08	FSQEIPRDL	0.4822	0.9849	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:09	QEIPRDLTL	0.4739	0.641	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:54	QEIPRDLTL	0.4209	0.9529	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:53	QEIPRDLTL	0.1847	0.96	12	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B07:13	FSQEIPRDL	0.1133	0.7605	10	19
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:53	SQEIPRDLTL	0.9746	0.9287	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:02	SQEIPRDLTL	0.9692	0.9642	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B40:04	SQEIPRDLTL	0.9657	0.725	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:73	SQEIPRDLTL	0.9616	0.9363	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B15:30	SQEIPRDLTL	0.9523	0.8499	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B39:11	SQEIPRDLTL	0.9477	0.9208	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:07	SQEIPRDLTL	0.705	0.9524	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:13	SQEIPRDLTL	0.705	0.9524	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B44:26	SQEIPRDLTL	0.705	0.9524	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B41:03	SQEIPRDLTL	0.6983	0.74	11	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:05	FSQEIPRDLTL	1	0.949	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:04	FSQEIPRDLTL	1	0.992	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:03	FSQEIPRDLTL	1	0.992	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:17	FSQEIPRDLTL	1	0.9754	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C15:05	FSQEIPRDLTL	0.9999	0.922	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C03:06	FSQEIPRDLTL	0.9996	0.9921	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-C17:01	FSQEIPRDLTL	0.9982	0.8267	10	21
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:05	QEIPRDLTLDA	0.9716	0.8291	12	23
MKS1-KSR1	chr17	56294027	chr17	25904518	271	HLA-B50:04	QEIPRDLTLDA	0.9716	0.8291	12	23

Top

Potential FusionNeoAntigen Information of MKS1-KSR1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MKS1-KSR1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7222	QEKLFSQEIPRDLT	MKS1	KSR1	chr17	56294027	chr17	25904518	271

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MKS1-KSR1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7222	QEKLFSQEIPRDLT	-7.9962	-8.1096
HLA-B14:02	3BVN	7222	QEKLFSQEIPRDLT	-5.70842	-6.74372
HLA-B52:01	3W39	7222	QEKLFSQEIPRDLT	-6.83737	-6.95077
HLA-B52:01	3W39	7222	QEKLFSQEIPRDLT	-4.4836	-5.5189
HLA-A11:01	4UQ2	7222	QEKLFSQEIPRDLT	-10.0067	-10.1201
HLA-A11:01	4UQ2	7222	QEKLFSQEIPRDLT	-9.03915	-10.0745
HLA-A24:02	5HGA	7222	QEKLFSQEIPRDLT	-6.56204	-6.67544
HLA-A24:02	5HGA	7222	QEKLFSQEIPRDLT	-5.42271	-6.45801
HLA-B44:05	3DX8	7222	QEKLFSQEIPRDLT	-7.85648	-8.89178
HLA-B44:05	3DX8	7222	QEKLFSQEIPRDLT	-5.3978	-5.5112
HLA-A02:01	6TDR	7222	QEKLFSQEIPRDLT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of MKS1-KSR1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MKS1-KSR1	chr17	56294027	chr17	25904518	10	19	FSQEIPRDL	TTTAGCCAGGAGATCCCCCGAGACCTC
MKS1-KSR1	chr17	56294027	chr17	25904518	10	21	FSQEIPRDLTL	TTTAGCCAGGAGATCCCCCGAGACCTCACGCTG
MKS1-KSR1	chr17	56294027	chr17	25904518	11	21	SQEIPRDLTL	AGCCAGGAGATCCCCCGAGACCTCACGCTG
MKS1-KSR1	chr17	56294027	chr17	25904518	12	21	QEIPRDLTL	CAGGAGATCCCCCGAGACCTCACGCTG
MKS1-KSR1	chr17	56294027	chr17	25904518	12	23	QEIPRDLTLDA	CAGGAGATCCCCCGAGACCTCACGCTGGATGCC
MKS1-KSR1	chr17	56294027	chr17	25904518	6	15	QEKLFSQEI	CAGGAGAAGCTCTTTAGCCAGGAGATC
MKS1-KSR1	chr17	56294027	chr17	25904518	6	16	QEKLFSQEIP	CAGGAGAAGCTCTTTAGCCAGGAGATCCCC
MKS1-KSR1	chr17	56294027	chr17	25904518	8	17	KLFSQEIPR	AAGCTCTTTAGCCAGGAGATCCCCCGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MKS1-KSR1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	MKS1-KSR1	chr17	56294027	ENST00000337050	chr17	25904518	ENST00000319524	TCGA-E2-A14V-01A

Top

Potential target of CAR-T therapy development for MKS1-KSR1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MKS1-KSR1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MKS1-KSR1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)