Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MPHOSPH10-ATP6V1B1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MPHOSPH10-ATP6V1B1
	FusionPDB ID: 54685
	FusionGDB2.0 ID: 54685
		Hgene	Tgene
	Gene symbol	MPHOSPH10	ATP6V1B1
	Gene ID	10199	525
	Gene name	M-phase phosphoprotein 10	ATPase H+ transporting V1 subunit B1
	Synonyms	CT90\|MPP10\|MPP10P\|PPP1R106	ATP6B1\|RTA1B\|VATB\|VMA2\|VPP3
	Cytomap	2p13.3	2p13.3
	Type of gene	protein-coding	protein-coding
	Description	U3 small nucleolar ribonucleoprotein protein MPP10U3 small nucleolar ribonucleoproteinm phase phosphoprotein 10protein phosphatase 1, regulatory subunit 106	V-type proton ATPase subunit B, kidney isoformATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1H(+)-transporting two-sector ATPase, 58kD subunitH+-ATPase beta 1 subunitV-ATPase B1 subunitV-ATPase subunit B 1endomembrane proton pump 58 kDa s
	Modification date	20200313	20200313
	UniProtAcc	O00566 Main function of 5'-partner protein: FUNCTION: Component of the 60-80S U3 small nucleolar ribonucleoprotein (U3 snoRNP). Required for the early cleavages during pre-18S ribosomal RNA processing.	P15313 Main function of 5'-partner protein: FUNCTION: Non-catalytic subunit of the peripheral V1 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000244230, ENST00000498451, ENST00000468427,	ENST00000234396, ENST00000412314,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 7 X 2=56	1 X 2 X 1=2
	# samples	7	2
	** MAII score	log2(7/56*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(2/2*10)=3.32192809488736
Fusion gene context	PubMed: MPHOSPH10 [Title/Abstract] AND ATP6V1B1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MPHOSPH10 [Title/Abstract] AND ATP6V1B1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MPHOSPH10(71361927)-ATP6V1B1(71185176), # samples:2
Anticipated loss of major functional domain due to fusion event.	MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. MPHOSPH10-ATP6V1B1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MPHOSPH10	GO:0010923	negative regulation of phosphatase activity	19389623

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:71361927/chr2:71185176)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MPHOSPH10 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ATP6V1B1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000244230	MPHOSPH10	chr2	71361927	+	ENST00000234396	ATP6V1B1	chr2	71185176	+	3094	1450	316	2817	833
ENST00000244230	MPHOSPH10	chr2	71361927	+	ENST00000412314	ATP6V1B1	chr2	71185176	+	3047	1450	316	2766	816
ENST00000498451	MPHOSPH10	chr2	71361927	+	ENST00000234396	ATP6V1B1	chr2	71185176	+	2776	1132	10	2499	829
ENST00000498451	MPHOSPH10	chr2	71361927	+	ENST00000412314	ATP6V1B1	chr2	71185176	+	2729	1132	10	2448	812
ENST00000498451	MPHOSPH10	chr2	71365761	+	ENST00000234396	ATP6V1B1	chr2	71185175	+	3570	1926	1908	3293	461
ENST00000498451	MPHOSPH10	chr2	71365761	+	ENST00000412314	ATP6V1B1	chr2	71185175	+	3523	1926	1908	3242	444
ENST00000244230	MPHOSPH10	chr2	71361927	+	ENST00000234396	ATP6V1B1	chr2	71185175	+	3094	1450	316	2817	833
ENST00000244230	MPHOSPH10	chr2	71361927	+	ENST00000412314	ATP6V1B1	chr2	71185175	+	3047	1450	316	2766	816
ENST00000498451	MPHOSPH10	chr2	71361927	+	ENST00000234396	ATP6V1B1	chr2	71185175	+	2776	1132	10	2499	829
ENST00000498451	MPHOSPH10	chr2	71361927	+	ENST00000412314	ATP6V1B1	chr2	71185175	+	2729	1132	10	2448	812
ENST00000498451	MPHOSPH10	chr2	71365761	+	ENST00000234396	ATP6V1B1	chr2	71185176	+	3570	1926	1908	3293	461
ENST00000498451	MPHOSPH10	chr2	71365761	+	ENST00000412314	ATP6V1B1	chr2	71185176	+	3523	1926	1908	3242	444

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000244230	ENST00000234396	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185176	+	0.003108243	0.9968918
ENST00000244230	ENST00000412314	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185176	+	0.002566915	0.9974331
ENST00000498451	ENST00000234396	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185176	+	0.003331234	0.99666876
ENST00000498451	ENST00000412314	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185176	+	0.002853345	0.99714667
ENST00000498451	ENST00000234396	MPHOSPH10	chr2	71365761	+	ATP6V1B1	chr2	71185175	+	0.00131264	0.9986873
ENST00000498451	ENST00000412314	MPHOSPH10	chr2	71365761	+	ATP6V1B1	chr2	71185175	+	0.001284961	0.99871504
ENST00000244230	ENST00000234396	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185175	+	0.003108243	0.9968918
ENST00000244230	ENST00000412314	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185175	+	0.002566915	0.9974331
ENST00000498451	ENST00000234396	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185175	+	0.003331234	0.99666876
ENST00000498451	ENST00000412314	MPHOSPH10	chr2	71361927	+	ATP6V1B1	chr2	71185175	+	0.002853345	0.99714667
ENST00000498451	ENST00000234396	MPHOSPH10	chr2	71365761	+	ATP6V1B1	chr2	71185176	+	0.00131264	0.9986873
ENST00000498451	ENST00000412314	MPHOSPH10	chr2	71365761	+	ATP6V1B1	chr2	71185176	+	0.001284961	0.99871504

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MPHOSPH10-ATP6V1B1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MPHOSPH10	chr2	71361927	ATP6V1B1	chr2	71185175	1132	374	DEVKSSFEKRQEKFAQYAEIVHFTLP
MPHOSPH10	chr2	71361927	ATP6V1B1	chr2	71185175	1450	378	DEVKSSFEKRQEKFAQYAEIVHFTLP
MPHOSPH10	chr2	71361927	ATP6V1B1	chr2	71185176	1132	374	DEVKSSFEKRQEKFAQYAEIVHFTLP
MPHOSPH10	chr2	71361927	ATP6V1B1	chr2	71185176	1450	378	DEVKSSFEKRQEKFAQYAEIVHFTLP

Top

Potential FusionNeoAntigen Information of MPHOSPH10-ATP6V1B1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MPHOSPH10-ATP6V1B1_71361927_71185175.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B45:01	QEKFAQYA	0.9995	0.9643	10	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:01	RQEKFAQY	0.9994	0.873	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:02	QEKFAQYA	0.9993	0.7555	10	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:01	FEKRQEKF	0.9981	0.8331	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:25	RQEKFAQY	0.991	0.9149	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:01	QEKFAQYA	0.9264	0.8422	10	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:03	RQEKFAQY	0.9074	0.8152	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:05	KRQEKFAQY	0.9995	0.6914	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:04	KRQEKFAQY	0.9994	0.6298	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B47:01	KRQEKFAQY	0.6812	0.54	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B13:02	RQEKFAQYA	0.6518	0.8224	9	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B41:01	FEKRQEKFA	0.4362	0.657	6	15
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:03	KRQEKFAQY	0.2838	0.8237	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:18	KRQEKFAQY	0.2367	0.7656	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:01	FEKRQEKFA	0.1724	0.671	6	15
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:01	SSFEKRQEKF	0.9995	0.8649	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B58:02	SSFEKRQEKF	0.9982	0.7328	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:17	SSFEKRQEKF	0.9941	0.7939	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:03	SSFEKRQEKF	0.9936	0.9069	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B58:01	SSFEKRQEKF	0.9866	0.6997	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:03	KSSFEKRQEKF	0.9989	0.9303	3	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:01	KFAQYAEIVHF	0.9978	0.9011	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-A32:13	KFAQYAEIVHF	0.9975	0.9425	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:01	FEKRQEKFAQY	0.9922	0.6616	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:03	KFAQYAEIVHF	0.983	0.6981	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B13:01	KFAQYAEIVHF	0.979	0.9679	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:07	RQEKFAQY	0.9951	0.6907	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:04	RQEKFAQY	0.9666	0.9063	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:14	KRQEKFAQY	0.999	0.6082	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:03	KRQEKFAQY	0.9936	0.7039	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:95	KRQEKFAQY	0.9915	0.5902	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:27	KRQEKFAQY	0.9896	0.9324	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:05	KRQEKFAQY	0.9785	0.9315	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:19	KRQEKFAQY	0.9529	0.7021	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:46	KRQEKFAQY	0.9419	0.8806	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C04:07	SFEKRQEKF	0.9388	0.5378	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C04:10	SFEKRQEKF	0.9358	0.5217	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:80	KRQEKFAQY	0.9042	0.9404	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:67	KRQEKFAQY	0.9042	0.9404	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:10	KRQEKFAQY	0.8923	0.9497	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C12:16	KRQEKFAQY	0.078	0.9161	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:07	KFAQYAEIVHF	0.9984	0.7026	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:46	FEKRQEKFAQY	0.9761	0.7277	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:33	RQEKFAQY	0.9994	0.873	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:34	RQEKFAQY	0.9994	0.873	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:125	RQEKFAQY	0.9994	0.873	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:135	RQEKFAQY	0.9994	0.8745	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:27	RQEKFAQY	0.9994	0.8971	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:50	RQEKFAQY	0.9992	0.8776	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:06	FEKRQEKF	0.9984	0.8348	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:05	FEKRQEKF	0.9981	0.8331	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:08	FEKRQEKF	0.9978	0.7676	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:03	FEKRQEKF	0.9974	0.8169	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:11	FEKRQEKF	0.996	0.6979	6	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:35	RQEKFAQY	0.9955	0.8738	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:53	RQEKFAQY	0.9943	0.8568	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:54	RQEKFAQY	0.9916	0.8337	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:39	RQEKFAQY	0.9908	0.8612	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:68	RQEKFAQY	0.9518	0.6019	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:04	QEKFAQYA	0.9264	0.8422	10	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:05	QEKFAQYA	0.9264	0.8422	10	18
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B35:28	RQEKFAQY	0.9118	0.9467	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B48:02	RQEKFAQY	0.6512	0.9305	9	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:08	KRQEKFAQY	0.9995	0.5894	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:10	KRQEKFAQY	0.9994	0.7207	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:06	KRQEKFAQY	0.9966	0.6572	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:01	KRQEKFAQY	0.9939	0.5764	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B27:09	KRQEKFAQY	0.9906	0.683	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:17	KRQEKFAQY	0.9626	0.9498	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C04:01	SFEKRQEKF	0.9388	0.5378	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:02	KRQEKFAQY	0.9042	0.9404	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C18:01	SFEKRQEKF	0.8854	0.5581	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C07:22	KRQEKFAQY	0.7664	0.6346	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C06:08	KRQEKFAQY	0.7252	0.9908	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C14:02	SFEKRQEKF	0.6848	0.8041	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C14:03	SFEKRQEKF	0.6848	0.8041	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C04:04	SFEKRQEKF	0.2688	0.5513	5	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B48:02	KRQEKFAQY	0.2267	0.9399	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:05	FEKRQEKFA	0.1724	0.671	6	15
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B50:04	FEKRQEKFA	0.1724	0.671	6	15
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C06:06	KRQEKFAQY	0.1177	0.9849	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:54	KRQEKFAQY	0.0911	0.87	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C06:02	KRQEKFAQY	0.0598	0.9915	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C06:17	KRQEKFAQY	0.0598	0.9915	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:68	KRQEKFAQY	0.0586	0.5888	8	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:10	SSFEKRQEKF	0.9995	0.8649	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:04	SSFEKRQEKF	0.9991	0.5712	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B58:06	SSFEKRQEKF	0.9985	0.5951	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:02	SSFEKRQEKF	0.9974	0.7179	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C16:04	SSFEKRQEKF	0.9967	0.9384	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C16:02	SSFEKRQEKF	0.9908	0.9666	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:24	SSFEKRQEKF	0.9899	0.8343	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-C16:01	SSFEKRQEKF	0.9853	0.9286	4	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:04	KSSFEKRQEKF	0.9998	0.575	3	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B57:02	KSSFEKRQEKF	0.9993	0.7468	3	14
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:35	KFAQYAEIVHF	0.9985	0.8595	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:135	KFAQYAEIVHF	0.998	0.8999	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:50	KFAQYAEIVHF	0.998	0.9194	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:33	KFAQYAEIVHF	0.9978	0.9011	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:27	KFAQYAEIVHF	0.9978	0.9313	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:125	KFAQYAEIVHF	0.9978	0.9011	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:34	KFAQYAEIVHF	0.9978	0.9011	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:53	FEKRQEKFAQY	0.9977	0.7182	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:24	KFAQYAEIVHF	0.997	0.9329	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-A32:01	KFAQYAEIVHF	0.9967	0.9353	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:53	KFAQYAEIVHF	0.9957	0.874	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:08	FEKRQEKFAQY	0.9947	0.6782	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:06	FEKRQEKFAQY	0.9926	0.6738	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:03	FEKRQEKFAQY	0.9925	0.6489	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:05	FEKRQEKFAQY	0.9922	0.6616	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:68	KFAQYAEIVHF	0.9905	0.6068	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B18:11	FEKRQEKFAQY	0.9896	0.5701	6	17
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B48:02	KFAQYAEIVHF	0.9769	0.8943	12	23
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	1450	HLA-B15:54	KFAQYAEIVHF	0.9751	0.8436	12	23

Top

Potential FusionNeoAntigen Information of MPHOSPH10-ATP6V1B1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MPHOSPH10-ATP6V1B1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2339	FEKRQEKFAQYAEI	MPHOSPH10	ATP6V1B1	chr2	71361927	chr2	71185175	1450

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MPHOSPH10-ATP6V1B1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2339	FEKRQEKFAQYAEI	-7.9962	-8.1096
HLA-B14:02	3BVN	2339	FEKRQEKFAQYAEI	-5.70842	-6.74372
HLA-B52:01	3W39	2339	FEKRQEKFAQYAEI	-6.83737	-6.95077
HLA-B52:01	3W39	2339	FEKRQEKFAQYAEI	-4.4836	-5.5189
HLA-A11:01	4UQ2	2339	FEKRQEKFAQYAEI	-10.0067	-10.1201
HLA-A11:01	4UQ2	2339	FEKRQEKFAQYAEI	-9.03915	-10.0745
HLA-A24:02	5HGA	2339	FEKRQEKFAQYAEI	-6.56204	-6.67544
HLA-A24:02	5HGA	2339	FEKRQEKFAQYAEI	-5.42271	-6.45801
HLA-B44:05	3DX8	2339	FEKRQEKFAQYAEI	-7.85648	-8.89178
HLA-B44:05	3DX8	2339	FEKRQEKFAQYAEI	-5.3978	-5.5112
HLA-A02:01	6TDR	2339	FEKRQEKFAQYAEI	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of MPHOSPH10-ATP6V1B1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	10	18	QEKFAQYA	CAGGAAAAGTTTGCCCAGTATGCG
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	12	23	KFAQYAEIVHF	AAGTTTGCCCAGTATGCGGAGATCGTCCACTTC
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	3	14	KSSFEKRQEKF	AAATCCTCCTTTGAAAAAAGACAGGAAAAGTTT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	4	14	SSFEKRQEKF	TCCTCCTTTGAAAAAAGACAGGAAAAGTTT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	5	14	SFEKRQEKF	TCCTTTGAAAAAAGACAGGAAAAGTTT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	6	14	FEKRQEKF	TTTGAAAAAAGACAGGAAAAGTTT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	6	15	FEKRQEKFA	TTTGAAAAAAGACAGGAAAAGTTTGCC
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	6	17	FEKRQEKFAQY	TTTGAAAAAAGACAGGAAAAGTTTGCCCAGTAT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	8	17	KRQEKFAQY	AAAAGACAGGAAAAGTTTGCCCAGTAT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	9	17	RQEKFAQY	AGACAGGAAAAGTTTGCCCAGTAT
MPHOSPH10-ATP6V1B1	chr2	71361927	chr2	71185175	9	18	RQEKFAQYA	AGACAGGAAAAGTTTGCCCAGTATGCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MPHOSPH10-ATP6V1B1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	MPHOSPH10-ATP6V1B1	chr2	71361927	ENST00000244230	chr2	71185175	ENST00000234396	TCGA-24-1846

Top

Potential target of CAR-T therapy development for MPHOSPH10-ATP6V1B1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MPHOSPH10-ATP6V1B1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MPHOSPH10-ATP6V1B1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)