Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MPRIP-TOM1L2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MPRIP-TOM1L2
	FusionPDB ID: 54793
	FusionGDB2.0 ID: 54793
		Hgene	Tgene
	Gene symbol	MPRIP	TOM1L2
	Gene ID	23164	146691
	Gene name	myosin phosphatase Rho interacting protein	target of myb1 like 2 membrane trafficking protein
	Synonyms	M-RIP\|MRIP\|RHOIP3\|RIP3\|p116Rip	-
	Cytomap	17p11.2	17p11.2
	Type of gene	protein-coding	protein-coding
	Description	myosin phosphatase Rho-interacting proteinRho interacting protein 3	TOM1-like protein 2target of Myb-like protein 2target of myb1-like 2
	Modification date	20200313	20200313
	UniProtAcc	Q6WCQ1 Main function of 5'-partner protein: FUNCTION: Targets myosin phosphatase to the actin cytoskeleton. Required for the regulation of the actin cytoskeleton by RhoA and ROCK1. Depletion leads to an increased number of stress fibers in smooth muscle cells through stabilization of actin fibers by phosphorylated myosin. Overexpression of MRIP as well as its F-actin-binding region leads to disassembly of stress fibers in neuronal cells. {ECO:0000250\|UniProtKB:P97434, ECO:0000269\|PubMed:15545284, ECO:0000269\|PubMed:16257966}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000395807, ENST00000341712, ENST00000395804, ENST00000395806, ENST00000395811, ENST00000444976,	ENST00000318094, ENST00000379504, ENST00000395739, ENST00000478943, ENST00000535933, ENST00000540946, ENST00000542206, ENST00000581396, ENST00000577517,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	24 X 12 X 11=3168	8 X 8 X 4=256
	# samples	23	8
	** MAII score	log2(23/3168*10)=-3.78386656913523 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/256*10)=-1.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MPRIP [Title/Abstract] AND TOM1L2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MPRIP [Title/Abstract] AND TOM1L2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MPRIP(16946285)-TOM1L2(17766162), # samples:4
Anticipated loss of major functional domain due to fusion event.	MPRIP-TOM1L2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MPRIP-TOM1L2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MPRIP-TOM1L2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MPRIP-TOM1L2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MPRIP-TOM1L2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. MPRIP-TOM1L2 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TOM1L2	GO:0007165	signal transduction	16479011
Tgene	TOM1L2	GO:0045839	negative regulation of mitotic nuclear division	16479011

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:16946285/chr17:17766162)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MPRIP (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TOM1L2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17754266	-	4579	212	729	154	191
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17754266	-	1268	212	729	154	191
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17754266	-	1244	212	729	154	191
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17754266	-	744	212	729	154	191
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17754266	-	647	212	627	154	157
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17754266	-	4570	203	720	145	191
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17754266	-	1259	203	720	145	191
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17754266	-	1235	203	720	145	191
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17754266	-	735	203	720	145	191
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17754266	-	638	203	618	145	157
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17754266	-	4546	179	696	121	191
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17754266	-	1235	179	696	121	191
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17754266	-	1211	179	696	121	191
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17754266	-	711	179	696	121	191
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17754266	-	614	179	594	121	157
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17754266	-	4490	123	640	65	191
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17754266	-	1179	123	640	65	191
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17754266	-	1155	123	640	65	191
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17754266	-	655	123	0	368	122
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17754266	-	558	123	538	65	157
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17754266	-	4579	212	729	154	191
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17754266	-	1268	212	729	154	191
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17754266	-	1244	212	729	154	191
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17754266	-	744	212	729	154	191
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17754266	-	647	212	627	154	157
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17752173	-	4519	212	2631	3155	174
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17752173	-	1208	212	669	154	171
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17752173	-	1184	212	669	154	171
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17752173	-	684	212	669	154	171
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17752173	-	587	212	567	154	137
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000540946	TOM1L2	chr17	17752173	-	564	212	561	154	135
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000542206	TOM1L2	chr17	17752173	-	464	212	89	397	102
ENST00000395811	MPRIP	chr17	16946285	+	ENST00000478943	TOM1L2	chr17	17752173	-	1208	212	669	154	171
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17752173	-	4510	203	2622	3146	174
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17752173	-	1199	203	660	145	171
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17752173	-	1175	203	660	145	171
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17752173	-	675	203	660	145	171
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17752173	-	578	203	558	145	137
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000540946	TOM1L2	chr17	17752173	-	555	203	552	145	135
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000542206	TOM1L2	chr17	17752173	-	455	203	80	388	102
ENST00000444976	MPRIP	chr17	16946285	+	ENST00000478943	TOM1L2	chr17	17752173	-	1199	203	660	145	171
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17752173	-	4486	179	2598	3122	174
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17752173	-	1175	179	636	121	171
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17752173	-	1151	179	636	121	171
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17752173	-	651	179	636	121	171
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17752173	-	554	179	534	121	137
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000540946	TOM1L2	chr17	17752173	-	531	179	528	121	135
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000542206	TOM1L2	chr17	17752173	-	431	179	56	364	102
ENST00000395804	MPRIP	chr17	16946285	+	ENST00000478943	TOM1L2	chr17	17752173	-	1175	179	636	121	171
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17752173	-	4430	123	2542	3066	174
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17752173	-	1119	123	580	65	171
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17752173	-	1095	123	580	65	171
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17752173	-	595	123	130	462	110
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17752173	-	498	123	478	65	137
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000540946	TOM1L2	chr17	17752173	-	475	123	130	462	110
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000542206	TOM1L2	chr17	17752173	-	375	123	0	308	102
ENST00000341712	MPRIP	chr17	16946285	+	ENST00000478943	TOM1L2	chr17	17752173	-	1119	123	580	65	171
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000581396	TOM1L2	chr17	17752173	-	4519	212	2631	3155	174
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000379504	TOM1L2	chr17	17752173	-	1208	212	669	154	171
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000318094	TOM1L2	chr17	17752173	-	1184	212	669	154	171
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000395739	TOM1L2	chr17	17752173	-	684	212	669	154	171
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000535933	TOM1L2	chr17	17752173	-	587	212	567	154	137
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000540946	TOM1L2	chr17	17752173	-	564	212	561	154	135
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000542206	TOM1L2	chr17	17752173	-	464	212	89	397	102
ENST00000395806	MPRIP	chr17	16946285	+	ENST00000478943	TOM1L2	chr17	17752173	-	1208	212	669	154	171

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000395811	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.32522044	0.6747796
ENST00000395811	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.007047309	0.99295264
ENST00000395811	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.006823722	0.9931763
ENST00000395811	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.004870143	0.9951298
ENST00000395811	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.003760051	0.9962399
ENST00000444976	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.32439384	0.6756062
ENST00000444976	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.007701246	0.9922988
ENST00000444976	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.008048854	0.9919511
ENST00000444976	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.004899781	0.9951002
ENST00000444976	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.00400046	0.9959996
ENST00000395804	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.32172772	0.67827225
ENST00000395804	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.007280222	0.99271977
ENST00000395804	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.007758268	0.99224174
ENST00000395804	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.00373213	0.99626786
ENST00000395804	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.002404956	0.997595
ENST00000341712	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.37206277	0.6279372
ENST00000341712	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.014856789	0.98514324
ENST00000341712	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.015430579	0.9845694
ENST00000341712	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.011058683	0.9889414
ENST00000341712	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.008266573	0.99173343
ENST00000395806	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.32522044	0.6747796
ENST00000395806	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.007047309	0.99295264
ENST00000395806	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.006823722	0.9931763
ENST00000395806	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.004870143	0.9951298
ENST00000395806	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17754266	-	0.003760051	0.9962399
ENST00000395811	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.33253974	0.66746026
ENST00000395811	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.23571065	0.7642893
ENST00000395811	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.2527377	0.7472623
ENST00000395811	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.16530368	0.83469635
ENST00000395811	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.095093444	0.9049066
ENST00000395811	ENST00000540946	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.09051138	0.9094886
ENST00000395811	ENST00000542206	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.012733986	0.98726606
ENST00000395811	ENST00000478943	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.23571065	0.7642893
ENST00000444976	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.33172712	0.6682729
ENST00000444976	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.30033788	0.69966215
ENST00000444976	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.32763627	0.67236376
ENST00000444976	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.18315978	0.8168402
ENST00000444976	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.0796148	0.9203852
ENST00000444976	ENST00000540946	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.08668317	0.91331685
ENST00000444976	ENST00000542206	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.013391672	0.9866084
ENST00000444976	ENST00000478943	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.30033788	0.69966215
ENST00000395804	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.32868153	0.6713185
ENST00000395804	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.24268414	0.7573159
ENST00000395804	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.24852704	0.751473
ENST00000395804	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.13529374	0.8647063
ENST00000395804	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.08268223	0.9173178
ENST00000395804	ENST00000540946	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.08866942	0.9113305
ENST00000395804	ENST00000542206	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.010883939	0.989116
ENST00000395804	ENST00000478943	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.24268414	0.7573159
ENST00000341712	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.3834524	0.6165476
ENST00000341712	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.40530118	0.5946988
ENST00000341712	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.43503505	0.5649649
ENST00000341712	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.25309384	0.7469062
ENST00000341712	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.26392347	0.73607653
ENST00000341712	ENST00000540946	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.23265442	0.76734555
ENST00000341712	ENST00000542206	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.023673045	0.97632694
ENST00000341712	ENST00000478943	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.40530118	0.5946988
ENST00000395806	ENST00000581396	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.33253974	0.66746026
ENST00000395806	ENST00000379504	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.23571065	0.7642893
ENST00000395806	ENST00000318094	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.2527377	0.7472623
ENST00000395806	ENST00000395739	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.16530368	0.83469635
ENST00000395806	ENST00000535933	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.095093444	0.9049066
ENST00000395806	ENST00000540946	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.09051138	0.9094886
ENST00000395806	ENST00000542206	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.012733986	0.98726606
ENST00000395806	ENST00000478943	MPRIP	chr17	16946285	+	TOM1L2	chr17	17752173	-	0.23571065	0.7642893

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MPRIP-TOM1L2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MPRIP	chr17	16946285	TOM1L2	chr17	17752173	123	38	FKPRESHLLNDEDLTQKGDDLEEGVT
MPRIP	chr17	16946285	TOM1L2	chr17	17752173	179	38	FKPRESHLLNDEDLTQKGDDLEEGVT
MPRIP	chr17	16946285	TOM1L2	chr17	17752173	203	38	FKPRESHLLNDEDLTQKGDDLEEGVT
MPRIP	chr17	16946285	TOM1L2	chr17	17752173	212	38	FKPRESHLLNDEDLTQKGDDLEEGVT
MPRIP	chr17	16946285	TOM1L2	chr17	17754266	123	41	RESHLLNDEDLTQIPVAQPSVMDDIE

Top

Potential FusionNeoAntigen Information of MPRIP-TOM1L2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MPRIP-TOM1L2_16946285_17754266.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B45:01	DEDLTQIPV	0.9892	0.8377	7	16
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:22	LLNDEDLTQI	0.9976	0.6135	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:27	LLNDEDLTQI	0.994	0.6053	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:13	LLNDEDLTQI	0.992	0.5867	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:60	LLNDEDLTQI	0.99	0.5079	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:11	LLNDEDLTQI	0.9888	0.5127	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B45:01	DEDLTQIPVA	0.9493	0.9148	7	17
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:21	TQIPVAQPSV	0.9321	0.6749	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B13:02	TQIPVAQPSV	0.9281	0.9745	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:35	LLNDEDLTQI	0.9116	0.5234	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:29	LLNDEDLTQI	0.8303	0.5027	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:20	LLNDEDLTQI	0.8182	0.5024	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:03	QIPVAQPSVM	0.7211	0.9015	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:02	QIPVAQPSVM	0.4685	0.9902	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:04	QIPVAQPSVM	0.4685	0.9902	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B52:01	TQIPVAQPSV	0.3811	0.994	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:01	TQIPVAQPSVM	0.9998	0.9618	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:22	HLLNDEDLTQI	0.9981	0.6802	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:27	HLLNDEDLTQI	0.9979	0.6413	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:13	HLLNDEDLTQI	0.9975	0.6726	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:60	HLLNDEDLTQI	0.997	0.5997	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:30	HLLNDEDLTQI	0.9967	0.5871	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:24	HLLNDEDLTQI	0.9967	0.5871	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:67	HLLNDEDLTQI	0.9967	0.5871	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:21	HLLNDEDLTQI	0.9966	0.7049	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:11	HLLNDEDLTQI	0.9957	0.5936	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:38	HLLNDEDLTQI	0.9768	0.6389	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:35	HLLNDEDLTQI	0.9736	0.62	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:03	TQIPVAQPSVM	0.9113	0.8904	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:29	HLLNDEDLTQI	0.8796	0.5938	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:20	HLLNDEDLTQI	0.8523	0.5908	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C05:09	LNDEDLTQI	0.9998	0.8779	5	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C08:15	LNDEDLTQI	0.999	0.9548	5	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:07	QIPVAQPSV	0.9198	0.6311	12	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C01:17	QIPVAQPSV	0.542	0.9736	12	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C01:30	QIPVAQPSV	0.5	0.976	12	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B07:12	QIPVAQPSVM	0.8529	0.7316	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B56:04	QIPVAQPSVM	0.5646	0.8074	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:12	QIPVAQPSVM	0.4685	0.9902	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:01	HLLNDEDLTQI	0.9967	0.5871	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B56:04	TQIPVAQPSVM	0.9383	0.8062	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B07:12	TQIPVAQPSVM	0.8718	0.7776	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C04:03	LNDEDLTQI	0.9998	0.6802	5	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C05:01	LNDEDLTQI	0.9998	0.8779	5	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C08:02	LNDEDLTQI	0.999	0.9548	5	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B18:03	DEDLTQIPV	0.7892	0.9274	7	16
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C01:03	QIPVAQPSV	0.6658	0.9783	12	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-C01:02	QIPVAQPSV	0.5582	0.974	12	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:03	LLNDEDLTQI	0.9981	0.6618	4	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:73	TQIPVAQPSV	0.9607	0.9867	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:14	TQIPVAQPSV	0.9355	0.6034	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:06	TQIPVAQPSV	0.9321	0.6749	11	21
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B56:02	QIPVAQPSVM	0.5646	0.8074	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B35:09	QIPVAQPSVM	0.4685	0.9902	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B55:04	QIPVAQPSVM	0.4593	0.7254	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B67:01	QIPVAQPSVM	0.3687	0.9891	12	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:125	TQIPVAQPSVM	0.9998	0.9618	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:33	TQIPVAQPSVM	0.9998	0.9618	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:34	TQIPVAQPSVM	0.9998	0.9618	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:53	TQIPVAQPSVM	0.9997	0.9615	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:54	TQIPVAQPSVM	0.9996	0.9554	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:73	TQIPVAQPSVM	0.9988	0.9932	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:30	TQIPVAQPSVM	0.9982	0.99	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-A02:06	HLLNDEDLTQI	0.9966	0.7049	3	14
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B15:12	TQIPVAQPSVM	0.9945	0.9324	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B67:01	TQIPVAQPSVM	0.9823	0.9886	11	22
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	HLA-B56:02	TQIPVAQPSVM	0.9383	0.8062	11	22

Top

Potential FusionNeoAntigen Information of MPRIP-TOM1L2 in HLA II

MPRIP-TOM1L2_16946285_17752173.msa
MPRIP-TOM1L2_16946285_17754266.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0413	ESHLLNDEDLTQKGD	4	19
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0422	ESHLLNDEDLTQKGD	4	19
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0422	RESHLLNDEDLTQKG	3	18
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0422	SHLLNDEDLTQKGDD	5	20
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0422	PRESHLLNDEDLTQK	2	17
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	123	DRB1-0472	ESHLLNDEDLTQKGD	4	19
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	DRB1-0422	ESHLLNDEDLTQIPV	1	16
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	123	DRB1-0422	RESHLLNDEDLTQIP	0	15

Top

Fusion breakpoint peptide structures of MPRIP-TOM1L2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6108	NDEDLTQIPVAQPS	MPRIP	TOM1L2	chr17	16946285	chr17	17754266	123

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MPRIP-TOM1L2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6108	NDEDLTQIPVAQPS	-7.9962	-8.1096
HLA-B14:02	3BVN	6108	NDEDLTQIPVAQPS	-5.70842	-6.74372
HLA-B52:01	3W39	6108	NDEDLTQIPVAQPS	-6.83737	-6.95077
HLA-B52:01	3W39	6108	NDEDLTQIPVAQPS	-4.4836	-5.5189
HLA-A11:01	4UQ2	6108	NDEDLTQIPVAQPS	-10.0067	-10.1201
HLA-A11:01	4UQ2	6108	NDEDLTQIPVAQPS	-9.03915	-10.0745
HLA-A24:02	5HGA	6108	NDEDLTQIPVAQPS	-6.56204	-6.67544
HLA-A24:02	5HGA	6108	NDEDLTQIPVAQPS	-5.42271	-6.45801
HLA-B44:05	3DX8	6108	NDEDLTQIPVAQPS	-7.85648	-8.89178
HLA-B44:05	3DX8	6108	NDEDLTQIPVAQPS	-5.3978	-5.5112
HLA-A02:01	6TDR	6108	NDEDLTQIPVAQPS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of MPRIP-TOM1L2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	11	21	TQIPVAQPSV	ACGCAGATCCCCGTTGCGCAGCCATCTGTC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	11	22	TQIPVAQPSVM	ACGCAGATCCCCGTTGCGCAGCCATCTGTCATG
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	12	21	QIPVAQPSV	CAGATCCCCGTTGCGCAGCCATCTGTC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	12	22	QIPVAQPSVM	CAGATCCCCGTTGCGCAGCCATCTGTCATG
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	3	14	HLLNDEDLTQI	CATCTGCTCAACGACGAGGACCTGACGCAGATC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	4	14	LLNDEDLTQI	CTGCTCAACGACGAGGACCTGACGCAGATC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	5	14	LNDEDLTQI	CTCAACGACGAGGACCTGACGCAGATC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	7	16	DEDLTQIPV	GACGAGGACCTGACGCAGATCCCCGTT
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	7	17	DEDLTQIPVA	GACGAGGACCTGACGCAGATCCCCGTTGCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	2	17	PRESHLLNDEDLTQK	TCGCATCTGCTCAACGACGAGGACCTGACGCAGAAGGGTGATGAT
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	3	18	RESHLLNDEDLTQKG	CATCTGCTCAACGACGAGGACCTGACGCAGAAGGGTGATGATCTG
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	4	19	ESHLLNDEDLTQKGD	CTGCTCAACGACGAGGACCTGACGCAGAAGGGTGATGATCTGGAG
MPRIP-TOM1L2	chr17	16946285	chr17	17752173	5	20	SHLLNDEDLTQKGDD	CTCAACGACGAGGACCTGACGCAGAAGGGTGATGATCTGGAGGAG
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	0	15	RESHLLNDEDLTQIP	CGCGAGTCGCATCTGCTCAACGACGAGGACCTGACGCAGATCCCC
MPRIP-TOM1L2	chr17	16946285	chr17	17754266	1	16	ESHLLNDEDLTQIPV	GAGTCGCATCTGCTCAACGACGAGGACCTGACGCAGATCCCCGTT

Top

Information of the samples that have these potential fusion neoantigens of MPRIP-TOM1L2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	MPRIP-TOM1L2	chr17	16946285	ENST00000341712	chr17	17754266	ENST00000395739	TCGA-K4-A5RH-01A

Top

Potential target of CAR-T therapy development for MPRIP-TOM1L2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MPRIP-TOM1L2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MPRIP-TOM1L2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)