Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MSH2-SLC3A1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MSH2-SLC3A1
	FusionPDB ID: 55274
	FusionGDB2.0 ID: 55274
		Hgene	Tgene
	Gene symbol	MSH2	SLC3A1
	Gene ID	4436	6519
	Gene name	mutS homolog 2	solute carrier family 3 member 1
	Synonyms	COCA1\|FCC1\|HNPCC\|HNPCC1\|LCFS2\|hMSH2	ATR1\|CSNU1\|D2H\|NBAT\|RBAT
	Cytomap	2p21-p16.3	2p21
	Type of gene	protein-coding	protein-coding
	Description	DNA mismatch repair protein Msh2DNA mismatch repair protein Msh2 transcriptmutS homolog 2, colon cancer, nonpolyposis type 1	neutral and basic amino acid transport protein rBATB(0,+)-type amino acid transport proteinSLC3A1 variant BSLC3A1 variant CSLC3A1 variant DSLC3A1 variant ESLC3A1 variant FSLC3A1 variant Gamino acid transporter 1solute carrier family 3 (amino acid
	Modification date	20200322	20200313
	UniProtAcc	P43246 Main function of 5'-partner protein: FUNCTION: Component of the post-replicative DNA mismatch repair system (MMR). Forms two different heterodimers: MutS alpha (MSH2-MSH6 heterodimer) and MutS beta (MSH2-MSH3 heterodimer) which binds to DNA mismatches thereby initiating DNA repair. When bound, heterodimers bend the DNA helix and shields approximately 20 base pairs. MutS alpha recognizes single base mismatches and dinucleotide insertion-deletion loops (IDL) in the DNA. MutS beta recognizes larger insertion-deletion loops up to 13 nucleotides long. After mismatch binding, MutS alpha or beta forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. Recruits DNA helicase MCM9 to chromatin which unwinds the mismatch containing DNA strand (PubMed:26300262). ATP binding and hydrolysis play a pivotal role in mismatch repair functions. The ATPase activity associated with MutS alpha regulates binding similar to a molecular switch: mismatched DNA provokes ADP-->ATP exchange, resulting in a discernible conformational transition that converts MutS alpha into a sliding clamp capable of hydrolysis-independent diffusion along the DNA backbone. This transition is crucial for mismatch repair. MutS alpha may also play a role in DNA homologous recombination repair. In melanocytes may modulate both UV-B-induced cell cycle regulation and apoptosis. {ECO:0000269\|PubMed:10078208, ECO:0000269\|PubMed:10660545, ECO:0000269\|PubMed:15064730, ECO:0000269\|PubMed:17611581, ECO:0000269\|PubMed:21120944, ECO:0000269\|PubMed:26300262, ECO:0000269\|PubMed:9564049, ECO:0000269\|PubMed:9822679, ECO:0000269\|PubMed:9822680}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000233146, ENST00000406134, ENST00000543555, ENST00000461394,	ENST00000409229, ENST00000409294, ENST00000409380, ENST00000409740, ENST00000409741, ENST00000410056, ENST00000260649, ENST00000409387,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 12 X 10=1800	1 X 2 X 1=2
	# samples	23	2
	** MAII score	log2(23/1800*10)=-2.96829114027266 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/2*10)=3.32192809488736
Fusion gene context	PubMed: MSH2 [Title/Abstract] AND SLC3A1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MSH2 [Title/Abstract] AND SLC3A1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MSH2(47637511)-SLC3A1(44539725), # samples:3
Anticipated loss of major functional domain due to fusion event.	MSH2-SLC3A1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MSH2-SLC3A1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MSH2	GO:0006281	DNA repair	8942985
Hgene	MSH2	GO:0006298	mismatch repair	7923193\|11555625
Hgene	MSH2	GO:0006301	postreplication repair	7923193
Hgene	MSH2	GO:0045910	negative regulation of DNA recombination	17715146
Hgene	MSH2	GO:0051096	positive regulation of helicase activity	17715146

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:47637511/chr2:44539725)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MSH2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SLC3A1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000233146	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539725	+	2449	868	223	1593	456
ENST00000233146	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539725	+	1791	868	223	1230	335
ENST00000543555	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539725	+	2167	586	7	1311	434
ENST00000543555	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539725	+	1509	586	7	948	313
ENST00000406134	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539725	+	2288	707	62	1432	456
ENST00000406134	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539725	+	1630	707	62	1069	335
ENST00000233146	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539724	+	2449	868	223	1593	456
ENST00000233146	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539724	+	1791	868	223	1230	335
ENST00000543555	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539724	+	2167	586	7	1311	434
ENST00000543555	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539724	+	1509	586	7	948	313
ENST00000406134	MSH2	chr2	47637511	+	ENST00000260649	SLC3A1	chr2	44539724	+	2288	707	62	1432	456
ENST00000406134	MSH2	chr2	47637511	+	ENST00000409387	SLC3A1	chr2	44539724	+	1630	707	62	1069	335

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000233146	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.00027961	0.9997204
ENST00000233146	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.000275799	0.9997242
ENST00000543555	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.000220753	0.9997793
ENST00000543555	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.000382571	0.99961746
ENST00000406134	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.000266209	0.99973375
ENST00000406134	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539725	+	0.000236939	0.9997631
ENST00000233146	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.00027961	0.9997204
ENST00000233146	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.000275799	0.9997242
ENST00000543555	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.000220753	0.9997793
ENST00000543555	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.000382571	0.99961746
ENST00000406134	ENST00000260649	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.000266209	0.99973375
ENST00000406134	ENST00000409387	MSH2	chr2	47637511	+	SLC3A1	chr2	44539724	+	0.000236939	0.9997631

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MSH2-SLC3A1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MSH2	chr2	47637511	SLC3A1	chr2	44539724	586	159	IQRKLGLCEFPDNDQFSNLEALLIQI
MSH2	chr2	47637511	SLC3A1	chr2	44539724	707	181	IQRKLGLCEFPDNDQFSNLEALLIQI
MSH2	chr2	47637511	SLC3A1	chr2	44539724	868	181	IQRKLGLCEFPDNDQFSNLEALLIQI
MSH2	chr2	47637511	SLC3A1	chr2	44539725	586	159	IQRKLGLCEFPDNDQFSNLEALLIQI
MSH2	chr2	47637511	SLC3A1	chr2	44539725	707	181	IQRKLGLCEFPDNDQFSNLEALLIQI
MSH2	chr2	47637511	SLC3A1	chr2	44539725	868	181	IQRKLGLCEFPDNDQFSNLEALLIQI

Top

Potential FusionNeoAntigen Information of MSH2-SLC3A1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MSH2-SLC3A1_47637511_44539724.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:03	CEFPDNDQF	0.9931	0.9002	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:01	CEFPDNDQF	0.9876	0.9593	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:01	FPDNDQFSNL	0.9914	0.9584	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:08	FPDNDQFSNL	0.9873	0.9351	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:03	FPDNDQFSNL	0.9868	0.9457	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:02	FPDNDQFSNL	0.9614	0.9381	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:04	FPDNDQFSNL	0.9614	0.9381	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:03	GLCEFPDNDQF	0.9543	0.9536	5	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C04:07	FPDNDQFSNL	0.9993	0.7468	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C04:10	FPDNDQFSNL	0.9993	0.7133	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C08:15	FPDNDQFSNL	0.998	0.9394	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:12	FPDNDQFSNL	0.9614	0.9381	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B39:10	FPDNDQFSNL	0.9377	0.9445	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B07:12	FPDNDQFSNL	0.8749	0.6961	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B42:02	FPDNDQFSNL	0.6884	0.6459	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B42:01	FPDNDQFSNL	0.6331	0.6375	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:13	CEFPDNDQF	0.9931	0.9002	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:07	CEFPDNDQF	0.9931	0.9002	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:26	CEFPDNDQF	0.9931	0.9002	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:08	CEFPDNDQF	0.988	0.782	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:05	CEFPDNDQF	0.9876	0.9593	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:04	CEFPDNDQF	0.9874	0.9643	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:06	CEFPDNDQF	0.981	0.9619	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B40:04	CEFPDNDQF	0.9708	0.5496	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:03	CEFPDNDQF	0.8954	0.9554	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:11	CEFPDNDQF	0.7549	0.9175	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:20	CEFPDNDQF	0.664	0.8799	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B48:02	CEFPDNDQF	0.4026	0.8495	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B15:53	CEFPDNDQF	0.1327	0.7972	7	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C04:01	FPDNDQFSNL	0.9993	0.7468	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C04:03	FPDNDQFSNL	0.9993	0.8061	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-C08:02	FPDNDQFSNL	0.998	0.9394	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:77	FPDNDQFSNL	0.9914	0.9584	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:13	FPDNDQFSNL	0.9857	0.9493	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B35:09	FPDNDQFSNL	0.9614	0.9381	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B67:01	FPDNDQFSNL	0.9285	0.8694	9	19
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B18:11	LCEFPDNDQF	0.7763	0.9518	6	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:13	GLCEFPDNDQF	0.9543	0.9536	5	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:07	GLCEFPDNDQF	0.9543	0.9536	5	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B44:26	GLCEFPDNDQF	0.9543	0.9536	5	16
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	HLA-B40:04	GLCEFPDNDQF	0.8445	0.7045	5	16

Top

Potential FusionNeoAntigen Information of MSH2-SLC3A1 in HLA II

MSH2-SLC3A1_47637511_44539724.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0101	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0105	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0107	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0111	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0117	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0117	PDNDQFSNLEALLIQ	10	25
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0119	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0121	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0125	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0127	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0129	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0129	PDNDQFSNLEALLIQ	10	25
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-0131	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-1222	DNDQFSNLEALLIQI	11	26
MSH2-SLC3A1	chr2	47637511	chr2	44539724	868	DRB1-1222	PDNDQFSNLEALLIQ	10	25

Top

Fusion breakpoint peptide structures of MSH2-SLC3A1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4809	LCEFPDNDQFSNLE	MSH2	SLC3A1	chr2	47637511	chr2	44539724	868

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MSH2-SLC3A1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4809	LCEFPDNDQFSNLE	-7.02924	-7.14264
HLA-B14:02	3BVN	4809	LCEFPDNDQFSNLE	-3.38077	-4.41607
HLA-B52:01	3W39	4809	LCEFPDNDQFSNLE	-6.41355	-6.52695
HLA-B52:01	3W39	4809	LCEFPDNDQFSNLE	-4.44188	-5.47718
HLA-A24:02	5HGA	4809	LCEFPDNDQFSNLE	-7.76595	-8.80125
HLA-A24:02	5HGA	4809	LCEFPDNDQFSNLE	-7.30892	-7.42232
HLA-B44:05	3DX8	4809	LCEFPDNDQFSNLE	-5.65486	-5.76826
HLA-B44:05	3DX8	4809	LCEFPDNDQFSNLE	-2.95775	-3.99305

Top

Vaccine Design for the FusionNeoAntigens of MSH2-SLC3A1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MSH2-SLC3A1	chr2	47637511	chr2	44539724	5	16	GLCEFPDNDQF	GGAGACATGGGGAAACTGAGACAGATTGGTGGA
MSH2-SLC3A1	chr2	47637511	chr2	44539724	6	16	LCEFPDNDQF	GACATGGGGAAACTGAGACAGATTGGTGGA
MSH2-SLC3A1	chr2	47637511	chr2	44539724	7	16	CEFPDNDQF	ATGGGGAAACTGAGACAGATTGGTGGA
MSH2-SLC3A1	chr2	47637511	chr2	44539724	9	19	FPDNDQFSNL	AAACTGAGACAGATTGGTGGACCAGACAGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MSH2-SLC3A1	chr2	47637511	chr2	44539724	10	25	PDNDQFSNLEALLIQ	CTGAGACAGATTGGTGGACCAGACAGTTCACGGCTGACTTCGCGT
MSH2-SLC3A1	chr2	47637511	chr2	44539724	11	26	DNDQFSNLEALLIQI	AGACAGATTGGTGGACCAGACAGTTCACGGCTGACTTCGCGTTTG

Top

Information of the samples that have these potential fusion neoantigens of MSH2-SLC3A1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	MSH2-SLC3A1	chr2	47637511	ENST00000233146	chr2	44539724	ENST00000260649	TCGA-A2-A04U

Top

Potential target of CAR-T therapy development for MSH2-SLC3A1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MSH2-SLC3A1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MSH2-SLC3A1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)