Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MSI2-ERICH1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MSI2-ERICH1
	FusionPDB ID: 55312
	FusionGDB2.0 ID: 55312
		Hgene	Tgene
	Gene symbol	MSI2	ERICH1
	Gene ID	124540	157697
	Gene name	musashi RNA binding protein 2	glutamate rich 1
	Synonyms	MSI2H	HSPC319
	Cytomap	17q22	8p23.3
	Type of gene	protein-coding	protein-coding
	Description	RNA-binding protein Musashi homolog 2musashi homolog 2musashi-2	glutamate-rich protein 1
	Modification date	20200313	20200313
	UniProtAcc	Q96DH6 Main function of 5'-partner protein: FUNCTION: RNA binding protein that regulates the expression of target mRNAs at the translation level. May play a role in the proliferation and maintenance of stem cells in the central nervous system (By similarity). {ECO:0000250}.	Q86X53 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000579505, ENST00000284073, ENST00000322684, ENST00000416426, ENST00000442934, ENST00000579180,	ENST00000262109, ENST00000522706, ENST00000518277,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	40 X 16 X 16=10240	5 X 3 X 4=60
	# samples	45	5
	** MAII score	log2(45/10240*10)=-4.50814690367033 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/60*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MSI2 [Title/Abstract] AND ERICH1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MSI2 [Title/Abstract] AND ERICH1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MSI2(55607085)-ERICH1(624047), # samples:1
Anticipated loss of major functional domain due to fusion event.	MSI2-ERICH1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MSI2-ERICH1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MSI2-ERICH1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MSI2-ERICH1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:55607085/chr8:624047)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MSI2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ERICH1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000416426	MSI2	chr17	55607085	+	ENST00000522706	ERICH1	chr8	624047	-	2016	523	93	1538	481
ENST00000416426	MSI2	chr17	55607085	+	ENST00000262109	ERICH1	chr8	624047	-	1954	523	93	1550	485
ENST00000284073	MSI2	chr17	55607085	+	ENST00000522706	ERICH1	chr8	624047	-	2156	663	179	1678	499
ENST00000284073	MSI2	chr17	55607085	+	ENST00000262109	ERICH1	chr8	624047	-	2094	663	179	1690	503
ENST00000322684	MSI2	chr17	55607085	+	ENST00000522706	ERICH1	chr8	624047	-	1970	477	35	1492	485
ENST00000322684	MSI2	chr17	55607085	+	ENST00000262109	ERICH1	chr8	624047	-	1908	477	35	1504	489
ENST00000442934	MSI2	chr17	55607085	+	ENST00000522706	ERICH1	chr8	624047	-	1804	311	40	1326	428
ENST00000442934	MSI2	chr17	55607085	+	ENST00000262109	ERICH1	chr8	624047	-	1742	311	40	1338	432
ENST00000579180	MSI2	chr17	55607085	+	ENST00000522706	ERICH1	chr8	624047	-	1740	247	105	1262	385
ENST00000579180	MSI2	chr17	55607085	+	ENST00000262109	ERICH1	chr8	624047	-	1678	247	105	1274	389

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000416426	ENST00000522706	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.002673368	0.9973266
ENST00000416426	ENST00000262109	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.001184744	0.9988153
ENST00000284073	ENST00000522706	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.002442353	0.99755764
ENST00000284073	ENST00000262109	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.001033022	0.99896693
ENST00000322684	ENST00000522706	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.001287721	0.9987123
ENST00000322684	ENST00000262109	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.000517697	0.9994823
ENST00000442934	ENST00000522706	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.001439662	0.99856037
ENST00000442934	ENST00000262109	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.000582571	0.9994174
ENST00000579180	ENST00000522706	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.002178647	0.99782133
ENST00000579180	ENST00000262109	MSI2	chr17	55607085	+	ERICH1	chr8	624047	-	0.00091777	0.9990822

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MSI2-ERICH1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MSI2	chr17	55607085	ERICH1	chr8	624047	247	47	AMLMFDKTTNRHRDQDPHDQPKRRRI
MSI2	chr17	55607085	ERICH1	chr8	624047	311	90	AMLMFDKTTNRHRDQDPHDQPKRRRI
MSI2	chr17	55607085	ERICH1	chr8	624047	477	147	AMLMFDKTTNRHRDQDPHDQPKRRRI
MSI2	chr17	55607085	ERICH1	chr8	624047	523	143	AMLMFDKTTNRHRDQDPHDQPKRRRI
MSI2	chr17	55607085	ERICH1	chr8	624047	663	161	AMLMFDKTTNRHRDQDPHDQPKRRRI

Top

Potential FusionNeoAntigen Information of MSI2-ERICH1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA I

FusionNeoAntigen peptide

Binding score

Immunogenic score

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Potential FusionNeoAntigen Information of MSI2-ERICH1 in HLA II

MSI2-ERICH1_55607085_624047.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0301	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0303	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0313	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0318	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0320	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0322	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0326	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0328	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0330	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0332	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0334	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0336	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0342	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0344	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0346	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0348	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0350	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0352	AMLMFDKTTNRHRDQ	0	15
MSI2-ERICH1	chr17	55607085	chr8	624047	663	DRB1-0354	AMLMFDKTTNRHRDQ	0	15

Top

Fusion breakpoint peptide structures of MSI2-ERICH1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MSI2-ERICH1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele

PDB ID

File name

BPseq

Docking score

Glide score

Top

Vaccine Design for the FusionNeoAntigens of MSI2-ERICH1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide sequence

FusionNeoAntigen RNA sequence

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MSI2-ERICH1	chr17	55607085	chr8	624047	0	15	AMLMFDKTTNRHRDQ	CAATGCTGATGTTTGATAAAACTACCAACAGGCACAGAGATCAGG

Top

Information of the samples that have these potential fusion neoantigens of MSI2-ERICH1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type

Fusion gene

Hchr

Hbp

Henst

Tchr

Tbp

Tenst

Sample

Top

Potential target of CAR-T therapy development for MSI2-ERICH1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MSI2-ERICH1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MSI2-ERICH1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)