![]() |
|||||||
|
Fusion Protein:ABR-SAYSD1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ABR-SAYSD1 | FusionPDB ID: 560 | FusionGDB2.0 ID: 560 | Hgene | Tgene | Gene symbol | ABR | SAYSD1 | Gene ID | 29 | 55776 |
Gene name | ABR activator of RhoGEF and GTPase | SAYSVFN motif domain containing 1 | |
Synonyms | MDB | C6orf64 | |
Cytomap | 17p13.3 | 6p21.2 | |
Type of gene | protein-coding | protein-coding | |
Description | active breakpoint cluster region-related proteinABR, RhoGEF and GTPase activating proteinactive BCR-related | SAYSvFN domain-containing protein 1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q15018 Main function of 5'-partner protein: FUNCTION: Component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked polyubiquitin, leaving the last ubiquitin chain attached to its substrates (PubMed:19214193, PubMed:20032457, PubMed:20656690, PubMed:24075985). May act as a central scaffold protein that assembles the various components of the BRISC complex and retains them in the cytoplasm (PubMed:20656690). Plays a role in regulating the onset of apoptosis via its role in modulating 'Lys-63'-linked ubiquitination of target proteins (By similarity). Required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1 (PubMed:26195665). Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activities by enhancing its stability and cell surface expression (PubMed:24075985, PubMed:26344097). Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination (PubMed:24075985). Required for normal induction of p53/TP53 in response to DNA damage (PubMed:25283148). Independent of the BRISC complex, promotes interaction between USP7 and p53/TP53, and thereby promotes deubiquitination of p53/TP53, preventing its degradation and resulting in increased p53/TP53-mediated transcription regulation and p53/TP53-dependent apoptosis in response to DNA damage (PubMed:25283148). {ECO:0000250|UniProtKB:Q3TCJ1, ECO:0000269|PubMed:19214193, ECO:0000269|PubMed:20032457, ECO:0000269|PubMed:20656690, ECO:0000269|PubMed:24075985, ECO:0000269|PubMed:25283148}. | Q9NPB0 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000291107, ENST00000302538, ENST00000536794, ENST00000544583, ENST00000574437, ENST00000543210, ENST00000572441, ENST00000573895, | ENST00000481599, ENST00000229903, ENST00000373249, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 23 X 15 X 14=4830 | 2 X 1 X 2=4 |
# samples | 36 | 2 | |
** MAII score | log2(36/4830*10)=-3.74595437739346 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(2/4*10)=2.32192809488736 | |
Fusion gene context | PubMed: ABR [Title/Abstract] AND SAYSD1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ABR [Title/Abstract] AND SAYSD1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ABR(953289)-SAYSD1(39073552), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ABR-SAYSD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABR-SAYSD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABR-SAYSD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ABR-SAYSD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ABR-SAYSD1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ABR | GO:0090630 | activation of GTPase activity | 7479768 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:953289/chr6:39073552) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000544583 | ABR | chr17 | 953289 | - | ENST00000229903 | SAYSD1 | chr6 | 39073552 | - | 3966 | 2253 | 600 | 2597 | 665 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000544583 | ENST00000229903 | ABR | chr17 | 953289 | - | SAYSD1 | chr6 | 39073552 | - | 0.00250504 | 0.99749494 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ABR-SAYSD1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ABR | chr17 | 953289 | SAYSD1 | chr6 | 39073552 | 2253 | 551 | EIVDKIMGKGQIQEAAQPQGSTSETP |
Top |
Potential FusionNeoAntigen Information of ABR-SAYSD1 in HLA I |
![]() |
ABR-SAYSD1_953289_39073552.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | HLA-B08:09 | MGKGQIQEA | 0.871 | 0.8429 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of ABR-SAYSD1 in HLA II |
![]() |
ABR-SAYSD1_953289_39073552.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0801 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0806 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0806 | IVDKIMGKGQIQEAA | 1 | 16 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0806 | DKIMGKGQIQEAAQP | 3 | 18 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0806 | EIVDKIMGKGQIQEA | 0 | 15 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0808 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0810 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0810 | IVDKIMGKGQIQEAA | 1 | 16 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0811 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0812 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0812 | IVDKIMGKGQIQEAA | 1 | 16 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0816 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0822 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0822 | IVDKIMGKGQIQEAA | 1 | 16 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0826 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-0839 | VDKIMGKGQIQEAAQ | 2 | 17 |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 | DRB1-1478 | VDKIMGKGQIQEAAQ | 2 | 17 |
Top |
Fusion breakpoint peptide structures of ABR-SAYSD1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5911 | MGKGQIQEAAQPQG | ABR | SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2253 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ABR-SAYSD1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5911 | MGKGQIQEAAQPQG | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 5911 | MGKGQIQEAAQPQG | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 5911 | MGKGQIQEAAQPQG | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 5911 | MGKGQIQEAAQPQG | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 5911 | MGKGQIQEAAQPQG | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 5911 | MGKGQIQEAAQPQG | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 5911 | MGKGQIQEAAQPQG | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 5911 | MGKGQIQEAAQPQG | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 5911 | MGKGQIQEAAQPQG | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 5911 | MGKGQIQEAAQPQG | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 5911 | MGKGQIQEAAQPQG | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ABR-SAYSD1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 6 | 15 | MGKGQIQEA | ATGGGCAAAGGACAGATCCAGGAAGCG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 0 | 15 | EIVDKIMGKGQIQEA | GAGATCGTGGACAAGATCATGGGCAAAGGACAGATCCAGGAAGCG |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 1 | 16 | IVDKIMGKGQIQEAA | ATCGTGGACAAGATCATGGGCAAAGGACAGATCCAGGAAGCGGCT |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 2 | 17 | VDKIMGKGQIQEAAQ | GTGGACAAGATCATGGGCAAAGGACAGATCCAGGAAGCGGCTCAG |
ABR-SAYSD1 | chr17 | 953289 | chr6 | 39073552 | 3 | 18 | DKIMGKGQIQEAAQP | GACAAGATCATGGGCAAAGGACAGATCCAGGAAGCGGCTCAGCCC |
Top |
Information of the samples that have these potential fusion neoantigens of ABR-SAYSD1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | ABR-SAYSD1 | chr17 | 953289 | ENST00000544583 | chr6 | 39073552 | ENST00000229903 | 5263N |
Top |
Potential target of CAR-T therapy development for ABR-SAYSD1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | SAYSD1 | chr17:953289 | chr6:39073552 | ENST00000229903 | 0 | 2 | 106_126 | 0 | 184.0 | Transmembrane | Helical | |
Tgene | SAYSD1 | chr17:953289 | chr6:39073552 | ENST00000373249 | 0 | 2 | 106_126 | 0 | 117.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ABR-SAYSD1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ABR-SAYSD1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |