![]() |
|||||||
|
Fusion Protein:MYH10-CDKN2A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MYH10-CDKN2A | FusionPDB ID: 56273 | FusionGDB2.0 ID: 56273 | Hgene | Tgene | Gene symbol | MYH10 | CDKN2A | Gene ID | 4628 | 1029 |
Gene name | myosin heavy chain 10 | cyclin dependent kinase inhibitor 2A | |
Synonyms | NMMHC-IIB|NMMHCB | ARF|CDK4I|CDKN2|CMM2|INK4|INK4A|MLM|MTS-1|MTS1|P14|P14ARF|P16|P16-INK4A|P16INK4|P16INK4A|P19|P19ARF|TP16 | |
Cytomap | 17p13.1 | 9p21.3 | |
Type of gene | protein-coding | protein-coding | |
Description | myosin-10cellular myosin heavy chain, type Bmyosin heavy chain, nonmuscle type Bmyosin, heavy chain 10, non-musclemyosin, heavy polypeptide 10, non-musclenonmuscle myosin II heavy chain-Bnonmuscle myosin heavy chain IIB | cyclin-dependent kinase inhibitor 2ACDK4 inhibitor p16-INK4alternative reading framecell cycle negative regulator betacyclin-dependent kinase 4 inhibitor Acyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)multiple tumor suppressor 1 | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | P35580 Main function of 5'-partner protein: FUNCTION: Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping. Involved with LARP6 in the stabilization of type I collagen mRNAs for CO1A1 and CO1A2. During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the central part but not the margins of spreading cells), and lamellipodial extension; this function is mechanically antagonized by MYH9. {ECO:0000269|PubMed:20052411, ECO:0000269|PubMed:20603131}. | Q96HQ2 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000269243, ENST00000360416, ENST00000379980, ENST00000396239, | ENST00000446177, ENST00000479692, ENST00000494262, ENST00000497750, ENST00000498124, ENST00000498628, ENST00000530628, ENST00000578845, ENST00000470819, ENST00000304494, ENST00000579122, ENST00000361570, ENST00000579755, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 15 X 5=900 | 13 X 5 X 10=650 |
# samples | 15 | 16 | |
** MAII score | log2(15/900*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(16/650*10)=-2.02236781302845 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MYH10 [Title/Abstract] AND CDKN2A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MYH10 [Title/Abstract] AND CDKN2A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CDKN2A(21994138)-MYH10(8508300), # samples:2 MYH10(8526220)-CDKN2A(21971207), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | CDKN2A-MYH10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CDKN2A-MYH10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MYH10-CDKN2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MYH10-CDKN2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MYH10-CDKN2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MYH10-CDKN2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MYH10-CDKN2A seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. MYH10-CDKN2A seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MYH10 | GO:0000281 | mitotic cytokinesis | 15774463 |
Hgene | MYH10 | GO:0030048 | actin filament-based movement | 15845534 |
Tgene | CDKN2A | GO:0000082 | G1/S transition of mitotic cell cycle | 10208428 |
Tgene | CDKN2A | GO:0007050 | cell cycle arrest | 15149599 |
Tgene | CDKN2A | GO:0008285 | negative regulation of cell proliferation | 15149599 |
Tgene | CDKN2A | GO:0030308 | negative regulation of cell growth | 10208428 |
Tgene | CDKN2A | GO:0032088 | negative regulation of NF-kappaB transcription factor activity | 10353611 |
Tgene | CDKN2A | GO:0042326 | negative regulation of phosphorylation | 8259215|10208428 |
Tgene | CDKN2A | GO:0045736 | negative regulation of cyclin-dependent protein serine/threonine kinase activity | 7739547|8259215 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:21994138/chr9:8508300) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000360416 | MYH10 | chr17 | 8526220 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1282 | 484 | 139 | 804 | 221 |
ENST00000360416 | MYH10 | chr17 | 8526220 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1281 | 484 | 139 | 804 | 221 |
ENST00000379980 | MYH10 | chr17 | 8526220 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1239 | 441 | 96 | 761 | 221 |
ENST00000379980 | MYH10 | chr17 | 8526220 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1238 | 441 | 96 | 761 | 221 |
ENST00000396239 | MYH10 | chr17 | 8526220 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1239 | 441 | 96 | 761 | 221 |
ENST00000396239 | MYH10 | chr17 | 8526220 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1238 | 441 | 96 | 761 | 221 |
ENST00000269243 | MYH10 | chr17 | 8526220 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1282 | 484 | 139 | 804 | 221 |
ENST00000269243 | MYH10 | chr17 | 8526220 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1281 | 484 | 139 | 804 | 221 |
ENST00000360416 | MYH10 | chr17 | 8526219 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1282 | 484 | 139 | 804 | 221 |
ENST00000360416 | MYH10 | chr17 | 8526219 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1281 | 484 | 139 | 804 | 221 |
ENST00000379980 | MYH10 | chr17 | 8526219 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1239 | 441 | 96 | 761 | 221 |
ENST00000379980 | MYH10 | chr17 | 8526219 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1238 | 441 | 96 | 761 | 221 |
ENST00000396239 | MYH10 | chr17 | 8526219 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1239 | 441 | 96 | 761 | 221 |
ENST00000396239 | MYH10 | chr17 | 8526219 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1238 | 441 | 96 | 761 | 221 |
ENST00000269243 | MYH10 | chr17 | 8526219 | - | ENST00000361570 | CDKN2A | chr9 | 21971207 | - | 1282 | 484 | 139 | 804 | 221 |
ENST00000269243 | MYH10 | chr17 | 8526219 | - | ENST00000579755 | CDKN2A | chr9 | 21971207 | - | 1281 | 484 | 139 | 804 | 221 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000360416 | ENST00000361570 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002315942 | 0.997684 |
ENST00000360416 | ENST00000579755 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002307539 | 0.99769247 |
ENST00000379980 | ENST00000361570 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002127534 | 0.9978725 |
ENST00000379980 | ENST00000579755 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002118577 | 0.99788135 |
ENST00000396239 | ENST00000361570 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002127534 | 0.9978725 |
ENST00000396239 | ENST00000579755 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002118577 | 0.99788135 |
ENST00000269243 | ENST00000361570 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002315942 | 0.997684 |
ENST00000269243 | ENST00000579755 | MYH10 | chr17 | 8526220 | - | CDKN2A | chr9 | 21971207 | - | 0.002307539 | 0.99769247 |
ENST00000360416 | ENST00000361570 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002315942 | 0.997684 |
ENST00000360416 | ENST00000579755 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002307539 | 0.99769247 |
ENST00000379980 | ENST00000361570 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002127534 | 0.9978725 |
ENST00000379980 | ENST00000579755 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002118577 | 0.99788135 |
ENST00000396239 | ENST00000361570 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002127534 | 0.9978725 |
ENST00000396239 | ENST00000579755 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002118577 | 0.99788135 |
ENST00000269243 | ENST00000361570 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002315942 | 0.997684 |
ENST00000269243 | ENST00000579755 | MYH10 | chr17 | 8526219 | - | CDKN2A | chr9 | 21971207 | - | 0.002307539 | 0.99769247 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MYH10-CDKN2A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MYH10 | chr17 | 8526219 | CDKN2A | chr9 | 21971207 | 441 | 115 | HNLKDRYYSGLIYVMMMGSARVAELL |
MYH10 | chr17 | 8526219 | CDKN2A | chr9 | 21971207 | 484 | 115 | HNLKDRYYSGLIYVMMMGSARVAELL |
MYH10 | chr17 | 8526220 | CDKN2A | chr9 | 21971207 | 441 | 115 | HNLKDRYYSGLIYVMMMGSARVAELL |
MYH10 | chr17 | 8526220 | CDKN2A | chr9 | 21971207 | 484 | 115 | HNLKDRYYSGLIYVMMMGSARVAELL |
Top |
Potential FusionNeoAntigen Information of MYH10-CDKN2A in HLA I |
![]() |
MYH10-CDKN2A_8526219_21971207.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-A68:08 | YVMMMGSAR | 0.9817 | 0.5776 | 12 | 21 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-A68:05 | YVMMMGSAR | 0.974 | 0.5414 | 12 | 21 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-B15:18 | YYSGLIYVM | 0.4022 | 0.6328 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-B15:21 | YYSGLIYVM | 0.6386 | 0.878 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:10 | YYSGLIYVM | 0.6085 | 0.9635 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:05 | YYSGLIYVM | 0.6065 | 0.9723 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:80 | YYSGLIYVM | 0.5816 | 0.9344 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:67 | YYSGLIYVM | 0.5816 | 0.9344 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:19 | YYSGLIYVM | 0.5754 | 0.7389 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:27 | YYSGLIYVM | 0.5543 | 0.9613 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:29 | YYSGLIYVM | 0.5501 | 0.9547 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:95 | YYSGLIYVM | 0.5164 | 0.74 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:13 | YYSGLIYVM | 0.4802 | 0.891 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:46 | YYSGLIYVM | 0.4432 | 0.854 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-B39:12 | YYSGLIYVM | 0.363 | 0.9572 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C12:16 | YYSGLIYVM | 0.3409 | 0.9681 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C04:14 | YYSGLIYVM | 0.3183 | 0.5909 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C03:67 | YYSGLIYVM | 0.6584 | 0.9797 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:17 | YYSGLIYVM | 0.5845 | 0.9775 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:02 | YYSGLIYVM | 0.5816 | 0.9344 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:22 | YYSGLIYVM | 0.5302 | 0.7752 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:01 | YYSGLIYVM | 0.5181 | 0.7188 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C07:04 | YYSGLIYVM | 0.4753 | 0.8293 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C06:02 | YYSGLIYVM | 0.3921 | 0.9947 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C06:17 | YYSGLIYVM | 0.3921 | 0.9947 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C04:04 | YYSGLIYVM | 0.3402 | 0.6671 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C18:01 | YYSGLIYVM | 0.2367 | 0.5892 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C14:02 | YYSGLIYVM | 0.2223 | 0.9534 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C14:03 | YYSGLIYVM | 0.2223 | 0.9534 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C06:08 | YYSGLIYVM | 0.2113 | 0.9879 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C06:06 | YYSGLIYVM | 0.1259 | 0.989 | 6 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C14:03 | RYYSGLIYVM | 0.8296 | 0.9501 | 5 | 15 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | HLA-C14:02 | RYYSGLIYVM | 0.8296 | 0.9501 | 5 | 15 |
Top |
Potential FusionNeoAntigen Information of MYH10-CDKN2A in HLA II |
![]() |
MYH10-CDKN2A_8526219_21971207.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | DRB5-0102 | GLIYVMMMGSARVAE | 9 | 24 |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 | DRB5-0108N | GLIYVMMMGSARVAE | 9 | 24 |
Top |
Fusion breakpoint peptide structures of MYH10-CDKN2A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10877 | YYSGLIYVMMMGSA | MYH10 | CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 484 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MYH10-CDKN2A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10877 | YYSGLIYVMMMGSA | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 10877 | YYSGLIYVMMMGSA | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 10877 | YYSGLIYVMMMGSA | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 10877 | YYSGLIYVMMMGSA | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 10877 | YYSGLIYVMMMGSA | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 10877 | YYSGLIYVMMMGSA | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 10877 | YYSGLIYVMMMGSA | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 10877 | YYSGLIYVMMMGSA | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 10877 | YYSGLIYVMMMGSA | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 10877 | YYSGLIYVMMMGSA | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 10877 | YYSGLIYVMMMGSA | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of MYH10-CDKN2A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 12 | 21 | YVMMMGSAR | TATGTCATGATGATGGGCAGCGCCCGA |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 5 | 15 | RYYSGLIYVM | CGCTACTATTCAGGACTAATCTATGTCATG |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 6 | 15 | YYSGLIYVM | TACTATTCAGGACTAATCTATGTCATG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MYH10-CDKN2A | chr17 | 8526219 | chr9 | 21971207 | 9 | 24 | GLIYVMMMGSARVAE | GGACTAATCTATGTCATGATGATGGGCAGCGCCCGAGTGGCGGAG |
Top |
Information of the samples that have these potential fusion neoantigens of MYH10-CDKN2A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SARC | MYH10-CDKN2A | chr17 | 8526219 | ENST00000269243 | chr9 | 21971207 | ENST00000361570 | TCGA-SI-A71P |
Top |
Potential target of CAR-T therapy development for MYH10-CDKN2A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MYH10-CDKN2A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MYH10-CDKN2A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |