Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NAA15-SKP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NAA15-SKP1
	FusionPDB ID: 56952
	FusionGDB2.0 ID: 56952
		Hgene	Tgene
	Gene symbol	NAA15	SKP1
	Gene ID	80155	6500
	Gene name	N-alpha-acetyltransferase 15, NatA auxiliary subunit	S-phase kinase associated protein 1
	Synonyms	Ga19\|MRD50\|NARG1\|NAT1P\|NATH\|TBDN\|TBDN100	EMC19\|OCP-II\|OCP2\|SKP1A\|TCEB1L\|p19A
	Cytomap	4q31.1	5q31.1
	Type of gene	protein-coding	protein-coding
	Description	N-alpha-acetyltransferase 15, NatA auxiliary subunitN-terminal acetyltransferaseNMDA receptor regulated 1NMDA receptor-regulated protein 1gastric cancer antigen Ga19protein tubedown-1transcriptional coactivator tubedown-100tubedown-1	S-phase kinase-associated protein 1OCP-2RNA polymerase II elongation factor-like protein OCP2SIIIcyclin A/CDK2-associated p19cyclin-A/CDK2-associated protein p19organ of Corti protein 2organ of Corti protein IIp19skp1transcription elongation fact
	Modification date	20200313	20200327
	UniProtAcc	Q9BXJ9 Main function of 5'-partner protein: FUNCTION: Auxillary subunit of the N-terminal acetyltransferase A (NatA) complex which displays alpha (N-terminal) acetyltransferase activity. The NAT activity may be important for vascular, hematopoietic and neuronal growth and development. Required to control retinal neovascularization in adult ocular endothelial cells. In complex with XRCC6 and XRCC5 (Ku80), up-regulates transcription from the osteocalcin promoter. {ECO:0000269\|PubMed:11687548, ECO:0000269\|PubMed:12145306, ECO:0000269\|PubMed:15496142}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000296543, ENST00000398947, ENST00000480277, ENST00000515576,	ENST00000353411, ENST00000517625, ENST00000521216, ENST00000522552, ENST00000522855,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 10 X 7=1260	16 X 9 X 7=1008
	# samples	21	17
	** MAII score	log2(21/1260*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(17/1008*10)=-2.56788898736222 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NAA15 [Title/Abstract] AND SKP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NAA15 [Title/Abstract] AND SKP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NAA15(140222985)-SKP1(133509713), # samples:1
Anticipated loss of major functional domain due to fusion event.	NAA15-SKP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NAA15-SKP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NAA15-SKP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NAA15-SKP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NAA15	GO:0006474	N-terminal protein amino acid acetylation	15496142
Hgene	NAA15	GO:0045893	positive regulation of transcription, DNA-templated	12145306
Tgene	SKP1	GO:0016567	protein ubiquitination	15103331
Tgene	SKP1	GO:0031146	SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	15103331\|20347421
Tgene	SKP1	GO:0035518	histone H2A monoubiquitination	16943429

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:140222985/chr5:133509713)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NAA15 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SKP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000296543	NAA15	chr4	140222985	+	ENST00000353411	SKP1	chr5	133509713	-	9660	377	323	868	181
ENST00000296543	NAA15	chr4	140222985	+	ENST00000522552	SKP1	chr5	133509713	-	1950	377	323	859	178
ENST00000296543	NAA15	chr4	140222985	+	ENST00000521216	SKP1	chr5	133509713	-	1210	377	323	868	181
ENST00000296543	NAA15	chr4	140222985	+	ENST00000517625	SKP1	chr5	133509713	-	1094	377	323	868	181
ENST00000296543	NAA15	chr4	140222985	+	ENST00000522855	SKP1	chr5	133509713	-	1030	377	323	868	181
ENST00000398947	NAA15	chr4	140222985	+	ENST00000353411	SKP1	chr5	133509713	-	9527	244	190	735	181
ENST00000398947	NAA15	chr4	140222985	+	ENST00000522552	SKP1	chr5	133509713	-	1817	244	190	726	178
ENST00000398947	NAA15	chr4	140222985	+	ENST00000521216	SKP1	chr5	133509713	-	1077	244	190	735	181
ENST00000398947	NAA15	chr4	140222985	+	ENST00000517625	SKP1	chr5	133509713	-	961	244	190	735	181
ENST00000398947	NAA15	chr4	140222985	+	ENST00000522855	SKP1	chr5	133509713	-	897	244	190	735	181

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000296543	ENST00000353411	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.00054351	0.99945647
ENST00000296543	ENST00000522552	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000531656	0.9994684
ENST00000296543	ENST00000521216	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000630334	0.9993697
ENST00000296543	ENST00000517625	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000595674	0.9994043
ENST00000296543	ENST00000522855	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000749553	0.9992505
ENST00000398947	ENST00000353411	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000544156	0.99945587
ENST00000398947	ENST00000522552	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000430176	0.99956983
ENST00000398947	ENST00000521216	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000646962	0.999353
ENST00000398947	ENST00000517625	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000539174	0.9994609
ENST00000398947	ENST00000522855	NAA15	chr4	140222985	+	SKP1	chr5	133509713	-	0.000598477	0.99940157

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NAA15-SKP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NAA15	chr4	140222985	SKP1	chr5	133509713	244	18	LPPKENALFKRILMPSIKLQSSDGEI
NAA15	chr4	140222985	SKP1	chr5	133509713	377	18	LPPKENALFKRILMPSIKLQSSDGEI

Top

Potential FusionNeoAntigen Information of NAA15-SKP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NAA15-SKP1_140222985_133509713.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B08:01	ALFKRILM	0.9989	0.6617	6	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:05	KRILMPSIK	0.9995	0.936	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:04	KRILMPSIK	0.9961	0.8064	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B08:01	NALFKRILM	0.9939	0.5375	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-A32:13	RILMPSIKL	0.9412	0.9573	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-A30:08	RILMPSIKL	0.8766	0.7657	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-A02:20	RILMPSIKL	0.8378	0.63	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B13:01	RILMPSIKL	0.0546	0.9249	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:02	KRILMPSIKL	1	0.7122	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:05	KRILMPSIKL	1	0.8834	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:04	KRILMPSIKL	0.9999	0.8	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:14	KRILMPSIK	0.9988	0.86	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:03	KRILMPSIK	0.984	0.9458	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:14	KRILMPSIKL	1	0.8089	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:03	KRILMPSIKL	0.9991	0.8925	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:06	KRILMPSI	0.9999	0.8386	9	17
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B08:18	ALFKRILM	0.9989	0.6617	6	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:10	KRILMPSIK	0.9992	0.8896	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:08	KRILMPSIK	0.9991	0.8849	9	18
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B08:18	NALFKRILM	0.9939	0.5375	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-A32:01	RILMPSIKL	0.9915	0.9699	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-C16:04	NALFKRILM	0.9867	0.9873	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B08:12	NALFKRILM	0.889	0.7009	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-C16:01	NALFKRILM	0.8803	0.9696	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-C16:02	NALFKRILM	0.8144	0.9816	5	14
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-C17:01	RILMPSIKL	0.4921	0.9644	10	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:08	KRILMPSIKL	1	0.8511	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:06	KRILMPSIKL	0.9999	0.8179	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:10	KRILMPSIKL	0.9999	0.8691	9	19
NAA15-SKP1	chr4	140222985	chr5	133509713	377	HLA-B27:09	KRILMPSIKL	0.9998	0.8533	9	19

Top

Potential FusionNeoAntigen Information of NAA15-SKP1 in HLA II

NAA15-SKP1_140222985_133509713.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-0820	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1104	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1106	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1117	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1117	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1118	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1125	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1135	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1138	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1142	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1143	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1144	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1146	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1147	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1150	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1152	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1152	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1154	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1154	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1156	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1157	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1158	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1160	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1177	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1178	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1183	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1184	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1188	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1189	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1189	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1306	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1311	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1318	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1342	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1376	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1405	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1405	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1408	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1408	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1411	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1412	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1418	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1418	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1423	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1423	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1433	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1443	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1443	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1445	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1445	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1456	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1456	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1459	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1459	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1464	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1472	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1484	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1491	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1491	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1495	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1495	FKRILMPSIKLQSSD	8	23
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1496	KRILMPSIKLQSSDG	9	24
NAA15-SKP1	chr4	140222985	chr5	133509713	377	DRB1-1496	FKRILMPSIKLQSSD	8	23

Top

Fusion breakpoint peptide structures of NAA15-SKP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
359	ALFKRILMPSIKLQ	NAA15	SKP1	chr4	140222985	chr5	133509713	377

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NAA15-SKP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	359	ALFKRILMPSIKLQ	-5.03208	-5.26728
HLA-B14:02	3BVN	359	ALFKRILMPSIKLQ	-3.2204	-3.8823
HLA-B52:01	3W39	359	ALFKRILMPSIKLQ	-6.16213	-6.39733
HLA-B52:01	3W39	359	ALFKRILMPSIKLQ	-5.78576	-6.44766
HLA-A11:01	4UQ2	359	ALFKRILMPSIKLQ	-7.45012	-7.68532
HLA-A24:02	5HGA	359	ALFKRILMPSIKLQ	-8.27669	-8.93859
HLA-A24:02	5HGA	359	ALFKRILMPSIKLQ	-8.01702	-8.25222
HLA-B27:05	6PYJ	359	ALFKRILMPSIKLQ	-6.69849	-6.93369
HLA-B44:05	3DX8	359	ALFKRILMPSIKLQ	-5.25896	-5.49416
HLA-B44:05	3DX8	359	ALFKRILMPSIKLQ	-3.33803	-3.99993
HLA-A02:01	6TDR	359	ALFKRILMPSIKLQ	-5.05804	-5.29324

Top

Vaccine Design for the FusionNeoAntigens of NAA15-SKP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NAA15-SKP1	chr4	140222985	chr5	133509713	10	19	RILMPSIKL	CGGATCTTGATGCCTTCAATTAAGTTG
NAA15-SKP1	chr4	140222985	chr5	133509713	5	14	NALFKRILM	AATGCGCTCTTCAAGCGGATCTTGATG
NAA15-SKP1	chr4	140222985	chr5	133509713	6	14	ALFKRILM	GCGCTCTTCAAGCGGATCTTGATG
NAA15-SKP1	chr4	140222985	chr5	133509713	9	17	KRILMPSI	AAGCGGATCTTGATGCCTTCAATT
NAA15-SKP1	chr4	140222985	chr5	133509713	9	18	KRILMPSIK	AAGCGGATCTTGATGCCTTCAATTAAG
NAA15-SKP1	chr4	140222985	chr5	133509713	9	19	KRILMPSIKL	AAGCGGATCTTGATGCCTTCAATTAAGTTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
NAA15-SKP1	chr4	140222985	chr5	133509713	8	23	FKRILMPSIKLQSSD	TTCAAGCGGATCTTGATGCCTTCAATTAAGTTGCAGAGTTCTGAT
NAA15-SKP1	chr4	140222985	chr5	133509713	9	24	KRILMPSIKLQSSDG	AAGCGGATCTTGATGCCTTCAATTAAGTTGCAGAGTTCTGATGGA

Top

Information of the samples that have these potential fusion neoantigens of NAA15-SKP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	NAA15-SKP1	chr4	140222985	ENST00000296543	chr5	133509713	ENST00000353411	TCGA-CD-A486-01A

Top

Potential target of CAR-T therapy development for NAA15-SKP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NAA15-SKP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NAA15-SKP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)