|
|||||||
|
Fusion Protein:NDEL1-PDGFRB |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
| Fusion partner gene information | Fusion gene name: NDEL1-PDGFRB | FusionPDB ID: 57940 | FusionGDB2.0 ID: 57940 | Hgene | Tgene | Gene symbol | NDEL1 | PDGFRB | Gene ID | 81565 | 5159 |
| Gene name | nudE neurodevelopment protein 1 like 1 | platelet derived growth factor receptor beta | |
| Synonyms | EOPA|MITAP1|NDE1L1|NDE2|NUDEL | CD140B|IBGC4|IMF1|JTK12|KOGS|PDGFR|PDGFR-1|PDGFR1|PENTT | |
| Cytomap | 17p13.1 | 5q32 | |
| Type of gene | protein-coding | protein-coding | |
| Description | nuclear distribution protein nudE-like 1endooligopeptidase Amitosin-associated protein 1mitosin-associated protein MITAP1nudE nuclear distribution E homolog-like 1nudE nuclear distribution gene E homolog-like 1protein Nudel | platelet-derived growth factor receptor betaActivated tyrosine kinase PDGFRBCD140 antigen-like family member BNDEL1-PDGFRBPDGF-R-betaPDGFR-betabeta-type platelet-derived growth factor receptorplatelet-derived growth factor receptor 1platelet-deriv | |
| Modification date | 20200327 | 20200329 | |
| UniProtAcc | Q9GZM8 Main function of 5'-partner protein: FUNCTION: Required for organization of the cellular microtubule array and microtubule anchoring at the centrosome. May regulate microtubule organization at least in part by targeting the microtubule severing protein KATNA1 to the centrosome. Also positively regulates the activity of the minus-end directed microtubule motor protein dynein. May enhance dynein-mediated microtubule sliding by targeting dynein to the microtubule plus ends. Required for several dynein- and microtubule-dependent processes such as the maintenance of Golgi integrity, the centripetal motion of secretory vesicles and the coupling of the nucleus and centrosome. Also required during brain development for the migration of newly formed neurons from the ventricular/subventricular zone toward the cortical plate. Plays a role, together with DISC1, in the regulation of neurite outgrowth. Required for mitosis in some cell types but appears to be dispensible for mitosis in cortical neuronal progenitors, which instead requires NDE1. Facilitates the polymerization of neurofilaments from the individual subunits NEFH and NEFL. Positively regulates lysosome peripheral distribution and ruffled border formation in osteoclasts (By similarity). {ECO:0000250|UniProtKB:Q9ERR1, ECO:0000269|PubMed:12556484, ECO:0000269|PubMed:14970193, ECO:0000269|PubMed:16291865, ECO:0000269|PubMed:17600710}. | P09619 Main function of 5'-partner protein: FUNCTION: Tyrosine-protein kinase that acts as cell-surface receptor for homodimeric PDGFB and PDGFD and for heterodimers formed by PDGFA and PDGFB, and plays an essential role in the regulation of embryonic development, cell proliferation, survival, differentiation, chemotaxis and migration. Plays an essential role in blood vessel development by promoting proliferation, migration and recruitment of pericytes and smooth muscle cells to endothelial cells. Plays a role in the migration of vascular smooth muscle cells and the formation of neointima at vascular injury sites. Required for normal development of the cardiovascular system. Required for normal recruitment of pericytes (mesangial cells) in the kidney glomerulus, and for normal formation of a branched network of capillaries in kidney glomeruli. Promotes rearrangement of the actin cytoskeleton and the formation of membrane ruffles. Binding of its cognate ligands - homodimeric PDGFB, heterodimers formed by PDGFA and PDGFB or homodimeric PDGFD -leads to the activation of several signaling cascades; the response depends on the nature of the bound ligand and is modulated by the formation of heterodimers between PDGFRA and PDGFRB. Phosphorylates PLCG1, PIK3R1, PTPN11, RASA1/GAP, CBL, SHC1 and NCK1. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate, mobilization of cytosolic Ca(2+) and the activation of protein kinase C. Phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, leads to the activation of the AKT1 signaling pathway. Phosphorylation of SHC1, or of the C-terminus of PTPN11, creates a binding site for GRB2, resulting in the activation of HRAS, RAF1 and down-stream MAP kinases, including MAPK1/ERK2 and/or MAPK3/ERK1. Promotes phosphorylation and activation of SRC family kinases. Promotes phosphorylation of PDCD6IP/ALIX and STAM. Receptor signaling is down-regulated by protein phosphatases that dephosphorylate the receptor and its down-stream effectors, and by rapid internalization of the activated receptor. {ECO:0000269|PubMed:11297552, ECO:0000269|PubMed:11331881, ECO:0000269|PubMed:1314164, ECO:0000269|PubMed:1396585, ECO:0000269|PubMed:1653029, ECO:0000269|PubMed:1709159, ECO:0000269|PubMed:1846866, ECO:0000269|PubMed:20494825, ECO:0000269|PubMed:20529858, ECO:0000269|PubMed:21098708, ECO:0000269|PubMed:21679854, ECO:0000269|PubMed:21733313, ECO:0000269|PubMed:2554309, ECO:0000269|PubMed:26599395, ECO:0000269|PubMed:2835772, ECO:0000269|PubMed:2850496, ECO:0000269|PubMed:7685273, ECO:0000269|PubMed:7691811, ECO:0000269|PubMed:7692233, ECO:0000269|PubMed:8195171}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000299734, ENST00000334527, ENST00000380025, ENST00000402554, ENST00000583066, ENST00000585098, | ENST00000523456, ENST00000261799, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 7 X 8=560 | 28 X 26 X 6=4368 |
| # samples | 10 | 15 | |
| ** MAII score | log2(10/560*10)=-2.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/4368*10)=-4.86393845042397 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: NDEL1 [Title/Abstract] AND PDGFRB [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: NDEL1 [Title/Abstract] AND PDGFRB [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NDEL1(8354271)-PDGFRB(149506179), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | NDEL1-PDGFRB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NDEL1-PDGFRB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NDEL1-PDGFRB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NDEL1-PDGFRB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | PDGFRB | GO:0007165 | signal transduction | 10821867 |
| Tgene | PDGFRB | GO:0010863 | positive regulation of phospholipase C activity | 1653029 |
| Tgene | PDGFRB | GO:0018108 | peptidyl-tyrosine phosphorylation | 1653029|2536956|2850496 |
| Tgene | PDGFRB | GO:0030335 | positive regulation of cell migration | 17470632 |
| Tgene | PDGFRB | GO:0032516 | positive regulation of phosphoprotein phosphatase activity | 7691811 |
| Tgene | PDGFRB | GO:0038091 | positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway | 17470632 |
| Tgene | PDGFRB | GO:0043552 | positive regulation of phosphatidylinositol 3-kinase activity | 1314164 |
| Tgene | PDGFRB | GO:0046777 | protein autophosphorylation | 1314164|2536956|2850496 |
| Tgene | PDGFRB | GO:0048008 | platelet-derived growth factor receptor signaling pathway | 1314164|2536956 |
| Tgene | PDGFRB | GO:0060326 | cell chemotaxis | 2554309|17991872 |
Four levels of functional features of fusion genesGo to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:8354271/chr5:149506179) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across NDEL1 (5'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion gene breakpoints across PDGFRB (3'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000334527 | NDEL1 | chr17 | 8354271 | + | ENST00000261799 | PDGFRB | chr5 | 149506179 | - | 4565 | 897 | 107 | 2638 | 843 |
| ENST00000299734 | NDEL1 | chr17 | 8354271 | + | ENST00000261799 | PDGFRB | chr5 | 149506179 | - | 4565 | 897 | 107 | 2638 | 843 |
| ENST00000380025 | NDEL1 | chr17 | 8354271 | + | ENST00000261799 | PDGFRB | chr5 | 149506179 | - | 4526 | 858 | 68 | 2599 | 843 |
| ENST00000402554 | NDEL1 | chr17 | 8354271 | + | ENST00000261799 | PDGFRB | chr5 | 149506179 | - | 4518 | 850 | 60 | 2591 | 843 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000334527 | ENST00000261799 | NDEL1 | chr17 | 8354271 | + | PDGFRB | chr5 | 149506179 | - | 0.005784627 | 0.9942154 |
| ENST00000299734 | ENST00000261799 | NDEL1 | chr17 | 8354271 | + | PDGFRB | chr5 | 149506179 | - | 0.005784627 | 0.9942154 |
| ENST00000380025 | ENST00000261799 | NDEL1 | chr17 | 8354271 | + | PDGFRB | chr5 | 149506179 | - | 0.005872722 | 0.9941273 |
| ENST00000402554 | ENST00000261799 | NDEL1 | chr17 | 8354271 | + | PDGFRB | chr5 | 149506179 | - | 0.005841672 | 0.9941584 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NDEL1-PDGFRB |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| NDEL1 | chr17 | 8354271 | PDGFRB | chr5 | 149506179 | 850 | 261 | TPVGKGTENTFPSPKALPFKVVVISA |
| NDEL1 | chr17 | 8354271 | PDGFRB | chr5 | 149506179 | 858 | 261 | TPVGKGTENTFPSPKALPFKVVVISA |
| NDEL1 | chr17 | 8354271 | PDGFRB | chr5 | 149506179 | 897 | 261 | TPVGKGTENTFPSPKALPFKVVVISA |
Top |
Potential FusionNeoAntigen Information of NDEL1-PDGFRB in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| NDEL1-PDGFRB_8354271_149506179.msa |
Potential FusionNeoAntigen Information* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:02 | TENTFPSP | 0.9996 | 0.7472 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B45:01 | TENTFPSP | 0.9996 | 0.9663 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B41:01 | TENTFPSP | 0.9894 | 0.9447 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:01 | TENTFPSP | 0.9231 | 0.7513 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:01 | FPSPKALPF | 0.9992 | 0.8998 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:08 | FPSPKALPF | 0.9982 | 0.8664 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:02 | FPSPKALPF | 0.9965 | 0.8973 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:05 | FPSPKALPF | 0.9956 | 0.5438 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:03 | FPSPKALPF | 0.9952 | 0.8414 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:18 | FPSPKALPF | 0.9917 | 0.6927 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:01 | FPSPKALPF | 0.9832 | 0.6468 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:01 | FPSPKALPF | 0.9704 | 0.8805 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:02 | FPSPKALPF | 0.9704 | 0.8805 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:02 | FPSPKALPF | 0.9646 | 0.9334 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:04 | FPSPKALPF | 0.9646 | 0.9334 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:09 | FPSPKALPF | 0.9401 | 0.6988 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:37 | FPSPKALPF | 0.9278 | 0.5808 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:02 | NTFPSPKAL | 0.9244 | 0.8373 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:01 | NTFPSPKAL | 0.9244 | 0.8373 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:03 | NTFPSPKAL | 0.9241 | 0.9001 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:16 | NTFPSPKAL | 0.9137 | 0.7215 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:01 | SPKALPFKV | 0.7903 | 0.688 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:09 | SPKALPFKV | 0.7563 | 0.7661 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:02 | NTFPSPKAL | 0.7462 | 0.9537 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:04 | NTFPSPKAL | 0.7462 | 0.9537 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:10 | NTFPSPKAL | 0.7441 | 0.6605 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:37 | NTFPSPKAL | 0.5356 | 0.7483 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B52:01 | NTFPSPKAL | 0.4207 | 0.9673 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B45:01 | TENTFPSPKA | 0.9969 | 0.9578 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:25 | TFPSPKALPF | 0.9962 | 0.7207 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:20 | TFPSPKALPF | 0.9961 | 0.7177 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:15 | TFPSPKALPF | 0.9953 | 0.7226 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:31 | TFPSPKALPF | 0.995 | 0.7171 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:10 | TFPSPKALPF | 0.9903 | 0.5383 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:02 | TENTFPSPKA | 0.9888 | 0.7763 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:05 | SPKALPFKVV | 0.978 | 0.6529 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:17 | TFPSPKALPF | 0.9773 | 0.7115 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:02 | SPKALPFKVV | 0.9751 | 0.6467 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:05 | TFPSPKALPF | 0.9547 | 0.7334 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:05 | TFPSPKALPF | 0.8961 | 0.5346 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:02 | TFPSPKALPF | 0.8935 | 0.5005 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:14 | TFPSPKALPF | 0.8553 | 0.6881 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:01 | TENTFPSPKA | 0.8536 | 0.7782 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B41:01 | TENTFPSPKA | 0.806 | 0.9697 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B82:01 | TFPSPKALPF | 0.6226 | 0.5179 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A26:03 | ENTFPSPKAL | 0.3655 | 0.5248 | 7 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B44:03 | TENTFPSPKAL | 0.9978 | 0.9807 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:13 | TENTFPSPKAL | 0.9955 | 0.9731 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B81:01 | SPKALPFKVVV | 0.73 | 0.6404 | 12 | 23 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:14 | TFPSPKAL | 0.9604 | 0.913 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:17 | TFPSPKAL | 0.9602 | 0.9713 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:30 | TFPSPKAL | 0.9541 | 0.9821 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:31 | FPSPKALPF | 0.999 | 0.8394 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:08 | NTFPSPKAL | 0.9989 | 0.9063 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:07 | NTFPSPKAL | 0.9981 | 0.9702 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C15:06 | NTFPSPKAL | 0.998 | 0.9065 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C15:04 | NTFPSPKAL | 0.9979 | 0.8972 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:19 | NTFPSPKAL | 0.9978 | 0.9847 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:21 | FPSPKALPF | 0.9965 | 0.929 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:02 | FPSPKALPF | 0.9907 | 0.642 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:06 | NTFPSPKAL | 0.9877 | 0.8627 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:01 | FPSPKALPF | 0.9855 | 0.6376 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:12 | NTFPSPKAL | 0.9689 | 0.9505 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:12 | FPSPKALPF | 0.9646 | 0.9334 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:21 | NTFPSPKAL | 0.9561 | 0.9172 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:04 | NTFPSPKAL | 0.9536 | 0.9568 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:13 | NTFPSPKAL | 0.9536 | 0.9568 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:16 | NTFPSPKAL | 0.9485 | 0.9686 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:09 | FPSPKALPF | 0.9462 | 0.8307 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C06:03 | NTFPSPKAL | 0.9438 | 0.994 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:04 | NTFPSPKAL | 0.9387 | 0.9924 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:10 | FPSPKALPF | 0.9297 | 0.9617 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:03 | NTFPSPKAL | 0.9275 | 0.9817 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:12 | FPSPKALPF | 0.9192 | 0.96 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:14 | NTFPSPKAL | 0.9027 | 0.9739 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:02 | SPKALPFKV | 0.8914 | 0.7059 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B51:07 | FPSPKALPF | 0.8729 | 0.8769 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:01 | SPKALPFKV | 0.8686 | 0.7027 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:05 | NTFPSPKAL | 0.8656 | 0.9706 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:12 | SPKALPFKV | 0.8486 | 0.6261 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:01 | FPSPKALPF | 0.8482 | 0.5434 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:13 | NTFPSPKAL | 0.8399 | 0.9318 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:03 | FPSPKALPF | 0.8153 | 0.9764 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:27 | NTFPSPKAL | 0.8148 | 0.9541 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:12 | FPSPKALPF | 0.8136 | 0.5627 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:03 | NTFPSPKAL | 0.8075 | 0.8048 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:29 | NTFPSPKAL | 0.8 | 0.9435 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B14:03 | FPSPKALPF | 0.7999 | 0.9193 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:17 | NTFPSPKAL | 0.7948 | 0.9305 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B51:07 | SPKALPFKV | 0.7946 | 0.6747 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:10 | NTFPSPKAL | 0.7863 | 0.9714 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:13 | FPSPKALPF | 0.7727 | 0.9527 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:14 | FPSPKALPF | 0.7644 | 0.9756 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:29 | FPSPKALPF | 0.755 | 0.9473 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:12 | NTFPSPKAL | 0.7462 | 0.9537 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:10 | NTFPSPKAL | 0.7255 | 0.9288 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:27 | FPSPKALPF | 0.7244 | 0.9539 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:10 | FPSPKALPF | 0.7092 | 0.9745 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:80 | FPSPKALPF | 0.6973 | 0.9729 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:67 | FPSPKALPF | 0.6973 | 0.9729 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:95 | NTFPSPKAL | 0.6846 | 0.7222 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C02:06 | NTFPSPKAL | 0.6715 | 0.9765 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:30 | NTFPSPKAL | 0.6347 | 0.9633 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:19 | NTFPSPKAL | 0.6094 | 0.771 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:04 | FPSPKALPF | 0.557 | 0.9405 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:13 | FPSPKALPF | 0.557 | 0.9405 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B51:07 | NTFPSPKAL | 0.3548 | 0.9605 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:01 | NTFPSPKAL | 0.333 | 0.6499 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:14 | FPSPKALPF | 0.2317 | 0.8601 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:10 | SPKALPFKV | 0.0738 | 0.9415 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:10 | FPSPKALPF | 0.0054 | 0.8401 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:07 | FPSPKALPF | 0.0049 | 0.8373 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A24:02 | TFPSPKALPF | 0.9961 | 0.7177 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B40:06 | TENTFPSPKA | 0.9912 | 0.6794 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:04 | TFPSPKALPF | 0.9225 | 0.5267 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:02 | TFPSPKALPF | 0.9105 | 0.7709 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:12 | TFPSPKALPF | 0.9104 | 0.7743 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:01 | TFPSPKALPF | 0.8913 | 0.764 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:02 | SPKALPFKVV | 0.8599 | 0.836 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:01 | SPKALPFKVV | 0.8311 | 0.8301 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:04 | SPKALPFKVV | 0.8133 | 0.6492 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B56:04 | TFPSPKALPF | 0.748 | 0.6215 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B54:01 | FPSPKALPFKV | 0.9995 | 0.6458 | 10 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:08 | TENTFPSPKAL | 0.9988 | 0.9344 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:01 | FPSPKALPFKV | 0.9965 | 0.7102 | 10 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:02 | SPKALPFKVVV | 0.9842 | 0.8363 | 12 | 23 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:04 | SPKALPFKVVV | 0.9822 | 0.7591 | 12 | 23 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B42:01 | SPKALPFKVVV | 0.9812 | 0.8342 | 12 | 23 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:02 | TFPSPKAL | 0.9567 | 0.9706 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C14:02 | TFPSPKAL | 0.9445 | 0.9731 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C14:03 | TFPSPKAL | 0.9445 | 0.9731 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:03 | TFPSPKAL | 0.9328 | 0.9712 | 9 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:04 | TENTFPSP | 0.9231 | 0.7513 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:05 | TENTFPSP | 0.9231 | 0.7513 | 6 | 14 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:13 | FPSPKALPF | 0.9993 | 0.8376 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:77 | FPSPKALPF | 0.9992 | 0.8998 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:23 | FPSPKALPF | 0.9991 | 0.8753 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:04 | NTFPSPKAL | 0.9989 | 0.9821 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:03 | NTFPSPKAL | 0.9989 | 0.9821 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:20 | FPSPKALPF | 0.9989 | 0.9273 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:67 | NTFPSPKAL | 0.9982 | 0.9687 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:17 | NTFPSPKAL | 0.9979 | 0.9604 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C15:09 | NTFPSPKAL | 0.9979 | 0.8972 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:24 | FPSPKALPF | 0.9977 | 0.9453 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:05 | NTFPSPKAL | 0.9977 | 0.9077 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C15:02 | NTFPSPKAL | 0.9965 | 0.8836 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C15:05 | NTFPSPKAL | 0.9962 | 0.9104 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:11 | FPSPKALPF | 0.9962 | 0.9201 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:30 | FPSPKALPF | 0.9953 | 0.7638 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:02 | NTFPSPKAL | 0.9953 | 0.9682 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:17 | FPSPKALPF | 0.9953 | 0.7638 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:03 | FPSPKALPF | 0.9951 | 0.9678 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:04 | FPSPKALPF | 0.9951 | 0.9678 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:13 | FPSPKALPF | 0.995 | 0.8485 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:67 | FPSPKALPF | 0.9949 | 0.9545 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:02 | FPSPKALPF | 0.9944 | 0.9577 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C16:04 | NTFPSPKAL | 0.9865 | 0.9818 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:05 | FPSPKALPF | 0.9863 | 0.8735 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:04 | NTFPSPKAL | 0.9843 | 0.8433 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:18 | FPSPKALPF | 0.9832 | 0.6468 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A68:02 | NTFPSPKAL | 0.9831 | 0.5796 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:17 | FPSPKALPF | 0.983 | 0.9328 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:13 | FPSPKALPF | 0.9826 | 0.608 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B55:04 | FPSPKALPF | 0.9814 | 0.5162 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:02 | NTFPSPKAL | 0.9669 | 0.9728 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A25:01 | NTFPSPKAL | 0.9669 | 0.8989 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C03:06 | NTFPSPKAL | 0.9665 | 0.9835 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:09 | FPSPKALPF | 0.9646 | 0.9334 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:03 | NTFPSPKAL | 0.9641 | 0.9797 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A69:01 | NTFPSPKAL | 0.9544 | 0.7564 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B67:01 | FPSPKALPF | 0.9379 | 0.8929 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C06:06 | NTFPSPKAL | 0.9347 | 0.98 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C06:02 | NTFPSPKAL | 0.9312 | 0.9921 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C06:17 | NTFPSPKAL | 0.9312 | 0.9921 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:01 | NTFPSPKAL | 0.9275 | 0.9817 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:13 | NTFPSPKAL | 0.9206 | 0.9057 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B18:04 | FPSPKALPF | 0.9082 | 0.9485 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:04 | NTFPSPKAL | 0.8921 | 0.8831 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:03 | NTFPSPKAL | 0.8807 | 0.9087 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C16:01 | NTFPSPKAL | 0.8742 | 0.9754 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:02 | FPSPKALPF | 0.8718 | 0.727 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:02 | SPKALPFKV | 0.8662 | 0.5556 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:43 | NTFPSPKAL | 0.8445 | 0.869 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:22 | NTFPSPKAL | 0.8368 | 0.8099 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:12 | FPSPKALPF | 0.8187 | 0.7938 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C08:01 | FPSPKALPF | 0.8153 | 0.9764 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C01:02 | NTFPSPKAL | 0.8106 | 0.9265 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:17 | NTFPSPKAL | 0.8047 | 0.9704 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C16:02 | NTFPSPKAL | 0.7973 | 0.9832 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B08:18 | SPKALPFKV | 0.7903 | 0.688 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B18:07 | FPSPKALPF | 0.7837 | 0.9285 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:17 | FPSPKALPF | 0.7695 | 0.979 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C16:01 | FPSPKALPF | 0.7568 | 0.9784 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:09 | NTFPSPKAL | 0.7462 | 0.9537 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:13 | NTFPSPKAL | 0.713 | 0.8404 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B18:03 | FPSPKALPF | 0.7088 | 0.9376 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:02 | FPSPKALPF | 0.6973 | 0.9729 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:30 | NTFPSPKAL | 0.6622 | 0.8516 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C07:01 | NTFPSPKAL | 0.6554 | 0.7101 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B18:08 | FPSPKALPF | 0.6465 | 0.9401 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C06:08 | NTFPSPKAL | 0.6395 | 0.9909 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C02:02 | NTFPSPKAL | 0.6236 | 0.9838 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C02:10 | NTFPSPKAL | 0.6236 | 0.9838 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:43 | FPSPKALPF | 0.5434 | 0.852 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:08 | FPSPKALPF | 0.5405 | 0.8474 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:11 | FPSPKALPF | 0.5174 | 0.8354 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A25:01 | FPSPKALPF | 0.483 | 0.9512 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C12:02 | FPSPKALPF | 0.4441 | 0.9848 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:09 | NTFPSPKAL | 0.36 | 0.7551 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:04 | FPSPKALPF | 0.3418 | 0.9012 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B78:02 | NTFPSPKAL | 0.3396 | 0.7914 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C17:01 | NTFPSPKAL | 0.2914 | 0.9365 | 8 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B67:01 | SPKALPFKV | 0.1459 | 0.8831 | 12 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C18:01 | FPSPKALPF | 0.0063 | 0.8287 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C04:01 | FPSPKALPF | 0.0049 | 0.8373 | 10 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:08 | TFPSPKALPF | 0.9789 | 0.9433 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B15:11 | TFPSPKALPF | 0.9778 | 0.9453 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:22 | SPKALPFKVV | 0.9751 | 0.6467 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:30 | TFPSPKALPF | 0.957 | 0.8741 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B35:17 | TFPSPKALPF | 0.957 | 0.8741 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C14:03 | TFPSPKALPF | 0.9399 | 0.9828 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-C14:02 | TFPSPKALPF | 0.9399 | 0.9828 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:09 | TFPSPKALPF | 0.9244 | 0.5531 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B55:04 | TFPSPKALPF | 0.9201 | 0.742 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:22 | TFPSPKALPF | 0.8935 | 0.5005 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:05 | TENTFPSPKA | 0.8536 | 0.7782 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B50:04 | TENTFPSPKA | 0.8536 | 0.7782 | 6 | 16 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B56:02 | TFPSPKALPF | 0.748 | 0.6215 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B82:02 | TFPSPKALPF | 0.6226 | 0.5179 | 9 | 19 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B55:04 | SPKALPFKVV | 0.57 | 0.5686 | 12 | 22 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A68:02 | ENTFPSPKAL | 0.5599 | 0.6551 | 7 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A25:01 | ENTFPSPKAL | 0.3994 | 0.9282 | 7 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-A69:01 | ENTFPSPKAL | 0.37 | 0.7331 | 7 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B40:04 | TENTFPSPKAL | 0.9996 | 0.7046 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B44:07 | TENTFPSPKAL | 0.9978 | 0.9807 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B44:13 | TENTFPSPKAL | 0.9978 | 0.9807 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B41:03 | TENTFPSPKAL | 0.9978 | 0.7448 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B44:26 | TENTFPSPKAL | 0.9978 | 0.9807 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B39:02 | TENTFPSPKAL | 0.9969 | 0.9742 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B18:11 | TENTFPSPKAL | 0.993 | 0.9099 | 6 | 17 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B51:21 | FPSPKALPFKV | 0.9926 | 0.5178 | 10 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B51:14 | FPSPKALPFKV | 0.9903 | 0.5312 | 10 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B59:01 | FPSPKALPFKV | 0.9685 | 0.6017 | 10 | 21 |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 | HLA-B07:26 | SPKALPFKVVV | 0.8734 | 0.564 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of NDEL1-PDGFRB in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NDEL1-PDGFRB |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 9310 | TENTFPSPKALPFK | NDEL1 | PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 897 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NDEL1-PDGFRB |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens* We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 9310 | TENTFPSPKALPFK | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 9310 | TENTFPSPKALPFK | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 9310 | TENTFPSPKALPFK | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 9310 | TENTFPSPKALPFK | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 9310 | TENTFPSPKALPFK | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 9310 | TENTFPSPKALPFK | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 9310 | TENTFPSPKALPFK | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 9310 | TENTFPSPKALPFK | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 9310 | TENTFPSPKALPFK | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 9310 | TENTFPSPKALPFK | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 9310 | TENTFPSPKALPFK | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of NDEL1-PDGFRB |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 10 | 19 | FPSPKALPF | CACCGAAAGCCTTGCCCTTTAAGGTGG |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 10 | 21 | FPSPKALPFKV | CACCGAAAGCCTTGCCCTTTAAGGTGGTGGTGA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 12 | 21 | SPKALPFKV | AAGCCTTGCCCTTTAAGGTGGTGGTGA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 12 | 22 | SPKALPFKVV | AAGCCTTGCCCTTTAAGGTGGTGGTGATCT |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 12 | 23 | SPKALPFKVVV | AAGCCTTGCCCTTTAAGGTGGTGGTGATCTCAG |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 6 | 14 | TENTFPSP | ACACTTTTCCTTCACCGAAAGCCT |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 6 | 16 | TENTFPSPKA | ACACTTTTCCTTCACCGAAAGCCTTGCCCT |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 6 | 17 | TENTFPSPKAL | ACACTTTTCCTTCACCGAAAGCCTTGCCCTTTA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 7 | 17 | ENTFPSPKAL | CTTTTCCTTCACCGAAAGCCTTGCCCTTTA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 8 | 17 | NTFPSPKAL | TTCCTTCACCGAAAGCCTTGCCCTTTA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 9 | 17 | TFPSPKAL | CTTCACCGAAAGCCTTGCCCTTTA |
| NDEL1-PDGFRB | chr17 | 8354271 | chr5 | 149506179 | 9 | 19 | TFPSPKALPF | CTTCACCGAAAGCCTTGCCCTTTAAGGTGG |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NDEL1-PDGFRB |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| N/A | NDEL1-PDGFRB | chr17 | 8354271 | ENST00000299734 | chr5 | 149506179 | ENST00000261799 | LT626076 |
Top |
Potential target of CAR-T therapy development for NDEL1-PDGFRB |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features* Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | PDGFRB | chr17:8354271 | chr5:149506179 | ENST00000261799 | 9 | 23 | 533_553 | 0 | 1107.0 | Transmembrane | Helical |
Subcellular localization prediction of the transmembrane domain retained fusion proteins* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| NDEL1 | chr17 | 8354271 | ENST00000299734 | PDGFRB | chr5 | 149506179 | ENST00000261799 | ![]() |
Top |
Related Drugs to NDEL1-PDGFRB |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NDEL1-PDGFRB |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Tgene | PDGFRB | C3554321 | BASAL GANGLIA CALCIFICATION, IDIOPATHIC, 4 | 6 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| Tgene | PDGFRB | C0393590 | Fahr's syndrome (disorder) | 3 | GENOMICS_ENGLAND;ORPHANET |
| Tgene | PDGFRB | C4225270 | Kosaki overgrowth syndrome | 3 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Tgene | PDGFRB | C4551572 | MYOFIBROMATOSIS, INFANTILE, 1 | 3 | GENOMICS_ENGLAND;UNIPROT |
| Tgene | PDGFRB | C0013421 | Dystonia | 2 | GENOMICS_ENGLAND |
| Tgene | PDGFRB | C0023480 | Leukemia, Myelomonocytic, Chronic | 2 | ORPHANET |
| Tgene | PDGFRB | C0023893 | Liver Cirrhosis, Experimental | 2 | CTD_human |
| Tgene | PDGFRB | C0036341 | Schizophrenia | 2 | PSYGENET |
| Tgene | PDGFRB | C0432284 | Infantile myofibromatosis | 2 | CTD_human;GENOMICS_ENGLAND;ORPHANET |
| Tgene | PDGFRB | C0004782 | Basal Ganglia Diseases | 1 | CTD_human |
| Tgene | PDGFRB | C0006663 | Calcinosis | 1 | CTD_human |
| Tgene | PDGFRB | C0015371 | Extrapyramidal Disorders | 1 | CTD_human |
| Tgene | PDGFRB | C0036337 | Schizoaffective Disorder | 1 | PSYGENET |
| Tgene | PDGFRB | C0206648 | Myofibromatosis | 1 | GENOMICS_ENGLAND |
| Tgene | PDGFRB | C0263628 | Tumoral calcinosis | 1 | CTD_human |
| Tgene | PDGFRB | C0521174 | Microcalcification | 1 | CTD_human |
| Tgene | PDGFRB | C0750951 | Lenticulostriate Disorders | 1 | CTD_human |
| Tgene | PDGFRB | C1333046 | Myeloproliferative Neoplasm, Unclassifiable | 1 | ORPHANET |
| Tgene | PDGFRB | C1866182 | Penttinen-Aula syndrome | 1 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Tgene | PDGFRB | C3472621 | Myeloid neoplasm with beta-type platelet-derived growth factor receptor gene rearrangement | 1 | ORPHANET |
| Tgene | PDGFRB | C3714756 | Intellectual Disability | 1 | GENOMICS_ENGLAND |