Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NF1-ACACA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NF1-ACACA
	FusionPDB ID: 58666
	FusionGDB2.0 ID: 58666
		Hgene	Tgene
	Gene symbol	NF1	ACACA
	Gene ID	4763	31
	Gene name	neurofibromin 1	acetyl-CoA carboxylase alpha
	Synonyms	NFNS\|VRNF\|WSS	ACAC\|ACACAD\|ACC\|ACC1\|ACCA
	Cytomap	17q11.2	17q12
	Type of gene	protein-coding	protein-coding
	Description	neurofibrominneurofibromatosis 1neurofibromatosis-related protein NF-1truncated neurofibromin 1	acetyl-CoA carboxylase 1ACC-alphaacetyl-Coenzyme A carboxylase alpha
	Modification date	20200322	20200313
	UniProtAcc	P21359 Main function of 5'-partner protein: FUNCTION: Stimulates the GTPase activity of Ras. NF1 shows greater affinity for Ras GAP, but lower specific activity. May be a regulator of Ras activity. {ECO:0000269\|PubMed:2121371, ECO:0000269\|PubMed:8417346}.	Q13085 Main function of 5'-partner protein: FUNCTION: Cytosolic enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the first and rate-limiting step of de novo fatty acid biosynthesis (PubMed:20952656, PubMed:20457939, PubMed:29899443). This is a 2 steps reaction starting with the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain followed by the transfer of the carboxyl group from carboxylated biotin to acetyl-CoA (PubMed:20952656, PubMed:20457939, PubMed:29899443). {ECO:0000269\|PubMed:20457939, ECO:0000269\|PubMed:20952656, ECO:0000269\|PubMed:29899443}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000356175, ENST00000358273, ENST00000431387, ENST00000417592, ENST00000444181, ENST00000581113,	ENST00000361253, ENST00000416895, ENST00000588142, ENST00000589665, ENST00000335166, ENST00000353139, ENST00000360679, ENST00000394406,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	47 X 26 X 21=25662	20 X 22 X 7=3080
	# samples	69	21
	** MAII score	log2(69/25662*10)=-5.21689344093196 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(21/3080*10)=-3.87446911791614 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NF1 [Title/Abstract] AND ACACA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NF1 [Title/Abstract] AND ACACA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NF1(29422387)-ACACA(35518964), # samples:3
Anticipated loss of major functional domain due to fusion event.	NF1-ACACA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NF1-ACACA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NF1-ACACA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NF1-ACACA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NF1	GO:0043547	positive regulation of GTPase activity	2121371

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:29422387/chr17:35518964)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NF1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ACACA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000356175	NF1	chr17	29422387	+	ENST00000353139	ACACA	chr17	35518964	-	4844	443	254	2515	753
ENST00000356175	NF1	chr17	29422387	+	ENST00000360679	ACACA	chr17	35518964	-	4838	443	254	2515	753
ENST00000356175	NF1	chr17	29422387	+	ENST00000394406	ACACA	chr17	35518964	-	4838	443	254	2515	753
ENST00000356175	NF1	chr17	29422387	+	ENST00000335166	ACACA	chr17	35518964	-	3015	443	254	2515	753
ENST00000358273	NF1	chr17	29422387	+	ENST00000353139	ACACA	chr17	35518964	-	4844	443	254	2515	753
ENST00000358273	NF1	chr17	29422387	+	ENST00000360679	ACACA	chr17	35518964	-	4838	443	254	2515	753
ENST00000358273	NF1	chr17	29422387	+	ENST00000394406	ACACA	chr17	35518964	-	4838	443	254	2515	753
ENST00000358273	NF1	chr17	29422387	+	ENST00000335166	ACACA	chr17	35518964	-	3015	443	254	2515	753
ENST00000431387	NF1	chr17	29422387	+	ENST00000353139	ACACA	chr17	35518964	-	4794	393	204	2465	753
ENST00000431387	NF1	chr17	29422387	+	ENST00000360679	ACACA	chr17	35518964	-	4788	393	204	2465	753
ENST00000431387	NF1	chr17	29422387	+	ENST00000394406	ACACA	chr17	35518964	-	4788	393	204	2465	753
ENST00000431387	NF1	chr17	29422387	+	ENST00000335166	ACACA	chr17	35518964	-	2965	393	204	2465	753

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000356175	ENST00000353139	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001613614	0.9983864
ENST00000356175	ENST00000360679	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001618409	0.9983816
ENST00000356175	ENST00000394406	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001618409	0.9983816
ENST00000356175	ENST00000335166	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.002001529	0.9979984
ENST00000358273	ENST00000353139	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001613614	0.9983864
ENST00000358273	ENST00000360679	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001618409	0.9983816
ENST00000358273	ENST00000394406	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001618409	0.9983816
ENST00000358273	ENST00000335166	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.002001529	0.9979984
ENST00000431387	ENST00000353139	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001586026	0.9984139
ENST00000431387	ENST00000360679	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001592263	0.9984078
ENST00000431387	ENST00000394406	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001592263	0.9984078
ENST00000431387	ENST00000335166	NF1	chr17	29422387	+	ACACA	chr17	35518964	-	0.001925864	0.9980742

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NF1-ACACA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NF1	chr17	29422387	ACACA	chr17	35518964	393	62	VEWVQAVVSRFDEQIGMVAWKMTFKS
NF1	chr17	29422387	ACACA	chr17	35518964	443	62	VEWVQAVVSRFDEQIGMVAWKMTFKS

Top

Potential FusionNeoAntigen Information of NF1-ACACA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NF1-ACACA_29422387_35518964.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:01	DEQIGMVA	0.9817	0.9542	11	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:05	SRFDEQIGM	0.9997	0.9243	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:04	SRFDEQIGM	0.9997	0.8132	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:02	SRFDEQIGM	0.9996	0.7375	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:03	DEQIGMVAW	0.998	0.9747	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:02	DEQIGMVAW	0.9972	0.6167	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:06	SRFDEQIGM	0.9952	0.7806	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:01	SRFDEQIGM	0.9949	0.958	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:01	DEQIGMVAW	0.9937	0.9538	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B38:02	SRFDEQIGM	0.9925	0.9754	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B38:01	SRFDEQIGM	0.9911	0.9773	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B14:02	SRFDEQIGM	0.9876	0.6865	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B14:01	SRFDEQIGM	0.9876	0.6865	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:05	DEQIGMVAW	0.9784	0.6663	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:10	SRFDEQIGM	0.7953	0.7458	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:18	SRFDEQIGM	0.6232	0.8863	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B47:01	SRFDEQIGM	0.6222	0.7457	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:37	SRFDEQIGM	0.5503	0.8042	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:05	SRFDEQIGMV	0.9999	0.8483	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:04	SRFDEQIGMV	0.9998	0.7608	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:05	VSRFDEQIGM	0.9957	0.8672	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:02	VSRFDEQIGM	0.9952	0.7216	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:04	VSRFDEQIGM	0.9945	0.7606	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:02	FDEQIGMVAW	0.9862	0.5641	10	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:07	VSRFDEQIGM	0.9735	0.5931	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:06	SRFDEQIGMVA	0.9997	0.957	8	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:04	VVSRFDEQIGM	0.9985	0.6976	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-A24:17	RFDEQIGMVAW	0.9981	0.8251	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:02	VVSRFDEQIGM	0.9978	0.6439	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:05	VVSRFDEQIGM	0.9977	0.7818	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:02	RFDEQIGMVAW	0.9957	0.7257	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-A31:08	RFDEQIGMVAW	0.9957	0.9143	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:07	VVSRFDEQIGM	0.9956	0.6707	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:03	RFDEQIGMVAW	0.995	0.9852	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-A24:14	RFDEQIGMVAW	0.967	0.7268	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:07	RFDEQIGM	0.9999	0.8805	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:10	RFDEQIGM	0.9999	0.8735	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:14	RFDEQIGM	0.9847	0.8544	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:14	SRFDEQIGM	0.9997	0.8748	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:05	SRFDEQIGM	0.999	0.9811	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:10	RFDEQIGMV	0.9988	0.9032	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:95	SRFDEQIGM	0.9988	0.8201	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:07	RFDEQIGMV	0.9987	0.8897	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:27	SRFDEQIGM	0.9984	0.9748	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:13	SRFDEQIGM	0.9977	0.9636	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:29	SRFDEQIGM	0.9968	0.96	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:04	DEQIGMVAW	0.996	0.5989	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:12	SRFDEQIGM	0.9954	0.962	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:09	SRFDEQIGM	0.9952	0.6687	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:08	DEQIGMVAW	0.9945	0.7014	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:09	DEQIGMVAW	0.9936	0.7226	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:05	SRFDEQIGM	0.9878	0.9506	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:03	SRFDEQIGM	0.9875	0.93	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:67	SRFDEQIGM	0.9736	0.9704	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:80	SRFDEQIGM	0.9736	0.9704	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B73:01	SRFDEQIGM	0.957	0.6144	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:19	SRFDEQIGM	0.9563	0.8556	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:10	SRFDEQIGM	0.9437	0.9794	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:46	SRFDEQIGM	0.9148	0.9398	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:10	DEQIGMVAW	0.7307	0.7651	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:14	RFDEQIGMV	0.6804	0.8817	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B14:03	SRFDEQIGM	0.6257	0.7997	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C12:16	SRFDEQIGM	0.2077	0.9649	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:14	SRFDEQIGMV	0.9999	0.8232	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B73:01	SRFDEQIGMV	0.9982	0.8521	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:03	SRFDEQIGMV	0.9952	0.8613	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:14	VSRFDEQIGM	0.9952	0.8141	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:08	FDEQIGMVAW	0.9779	0.6419	10	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:03	VSRFDEQIGM	0.9028	0.8738	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:14	SRFDEQIGMVA	1	0.8661	8	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B73:01	SRFDEQIGMVA	0.9998	0.9541	8	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:08	RFDEQIGMVAW	0.9973	0.7469	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:04	RFDEQIGMVAW	0.9899	0.7021	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:03	VVSRFDEQIGM	0.9425	0.79	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:01	RFDEQIGM	0.9999	0.8805	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C18:01	RFDEQIGM	0.9999	0.8877	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:04	RFDEQIGM	0.9894	0.9311	9	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:06	DEQIGMVA	0.9832	0.9651	11	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:05	DEQIGMVA	0.9817	0.9542	11	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:03	DEQIGMVA	0.979	0.9472	11	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:13	EQIGMVAW	0.8963	0.9638	12	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:06	SRFDEQIGM	0.9998	0.8009	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:08	SRFDEQIGM	0.9998	0.8652	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:10	SRFDEQIGM	0.9997	0.9171	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:09	SRFDEQIGM	0.9996	0.8796	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:03	RFDEQIGMV	0.9992	0.9077	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:01	SRFDEQIGM	0.9988	0.8065	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:01	RFDEQIGMV	0.9987	0.8897	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C18:01	RFDEQIGMV	0.9984	0.9005	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:07	DEQIGMVAW	0.998	0.9747	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:13	DEQIGMVAW	0.998	0.9747	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:26	DEQIGMVAW	0.998	0.9747	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:22	DEQIGMVAW	0.9972	0.6167	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:07	DEQIGMVAW	0.9963	0.9412	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:04	DEQIGMVAW	0.9961	0.9541	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:31	SRFDEQIGM	0.9954	0.9594	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:02	SRFDEQIGM	0.9951	0.9686	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:08	DEQIGMVAW	0.9948	0.9858	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:05	DEQIGMVAW	0.9937	0.9538	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B38:05	SRFDEQIGM	0.9911	0.9773	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:17	SRFDEQIGM	0.9895	0.9722	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:03	DEQIGMVAW	0.9892	0.9506	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:06	DEQIGMVAW	0.9877	0.968	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C06:08	SRFDEQIGM	0.9777	0.9913	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:02	SRFDEQIGM	0.9736	0.9704	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:04	SRFDEQIGM	0.9225	0.9408	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:22	SRFDEQIGM	0.9024	0.7806	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:21	DEQIGMVAW	0.871	0.5082	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C03:67	SRFDEQIGM	0.79	0.9892	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C04:04	RFDEQIGMV	0.7874	0.94	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B18:11	DEQIGMVAW	0.783	0.9105	11	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C06:06	SRFDEQIGM	0.7774	0.9917	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B39:11	SRFDEQIGM	0.7267	0.7882	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:09	SRFDEQIGM	0.5871	0.7441	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C07:04	RFDEQIGMV	0.3176	0.9478	9	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C06:17	SRFDEQIGM	0.237	0.9931	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-C06:02	SRFDEQIGM	0.237	0.9931	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B15:68	SRFDEQIGM	0.2167	0.7982	8	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:08	SRFDEQIGMV	0.9999	0.757	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:10	SRFDEQIGMV	0.9998	0.8834	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:06	SRFDEQIGMV	0.9998	0.7744	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:09	SRFDEQIGMV	0.9998	0.8105	8	18
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:10	VSRFDEQIGM	0.9953	0.872	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:08	VSRFDEQIGM	0.9927	0.8008	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:22	FDEQIGMVAW	0.9862	0.5641	10	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:06	VSRFDEQIGM	0.986	0.7505	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:09	VSRFDEQIGM	0.9822	0.8144	7	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:08	SRFDEQIGMVA	1	0.8127	8	19
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:10	VVSRFDEQIGM	0.9985	0.8211	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:08	VVSRFDEQIGM	0.9978	0.7217	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:06	VVSRFDEQIGM	0.9972	0.7141	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B27:09	VVSRFDEQIGM	0.9964	0.7659	6	17
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:22	RFDEQIGMVAW	0.9957	0.7257	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:26	RFDEQIGMVAW	0.995	0.9852	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:13	RFDEQIGMVAW	0.995	0.9852	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:07	RFDEQIGMVAW	0.995	0.9852	9	20
NF1-ACACA	chr17	29422387	chr17	35518964	443	HLA-B44:21	RFDEQIGMVAW	0.9937	0.6549	9	20

Top

Potential FusionNeoAntigen Information of NF1-ACACA in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NF1-ACACA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10375	VVSRFDEQIGMVAW	NF1	ACACA	chr17	29422387	chr17	35518964	443

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NF1-ACACA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10375	VVSRFDEQIGMVAW	-6.27373	-6.38713
HLA-B14:02	3BVN	10375	VVSRFDEQIGMVAW	-2.64311	-3.67841
HLA-B52:01	3W39	10375	VVSRFDEQIGMVAW	-4.72164	-4.83504
HLA-B52:01	3W39	10375	VVSRFDEQIGMVAW	-2.92267	-3.95797
HLA-A11:01	4UQ2	10375	VVSRFDEQIGMVAW	-7.30182	-8.33712
HLA-A24:02	5HGA	10375	VVSRFDEQIGMVAW	-5.9697	-7.005
HLA-A24:02	5HGA	10375	VVSRFDEQIGMVAW	-5.36751	-5.48091
HLA-B44:05	3DX8	10375	VVSRFDEQIGMVAW	-4.10177	-4.21517
HLA-B44:05	3DX8	10375	VVSRFDEQIGMVAW	-3.4633	-4.4986
HLA-B35:01	1A1N	10375	VVSRFDEQIGMVAW	-4.67645	-4.78985
HLA-B35:01	1A1N	10375	VVSRFDEQIGMVAW	-3.578	-4.6133

Top

Vaccine Design for the FusionNeoAntigens of NF1-ACACA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NF1-ACACA	chr17	29422387	chr17	35518964	10	20	FDEQIGMVAW	GACGAGCAGATTGGCATGGTAGCTTGGAAA
NF1-ACACA	chr17	29422387	chr17	35518964	11	19	DEQIGMVA	GAGCAGATTGGCATGGTAGCTTGG
NF1-ACACA	chr17	29422387	chr17	35518964	11	20	DEQIGMVAW	GAGCAGATTGGCATGGTAGCTTGGAAA
NF1-ACACA	chr17	29422387	chr17	35518964	12	20	EQIGMVAW	CAGATTGGCATGGTAGCTTGGAAA
NF1-ACACA	chr17	29422387	chr17	35518964	6	17	VVSRFDEQIGM	GTCAGCCGCTTCGACGAGCAGATTGGCATGGTA
NF1-ACACA	chr17	29422387	chr17	35518964	7	17	VSRFDEQIGM	AGCCGCTTCGACGAGCAGATTGGCATGGTA
NF1-ACACA	chr17	29422387	chr17	35518964	8	17	SRFDEQIGM	CGCTTCGACGAGCAGATTGGCATGGTA
NF1-ACACA	chr17	29422387	chr17	35518964	8	18	SRFDEQIGMV	CGCTTCGACGAGCAGATTGGCATGGTAGCT
NF1-ACACA	chr17	29422387	chr17	35518964	8	19	SRFDEQIGMVA	CGCTTCGACGAGCAGATTGGCATGGTAGCTTGG
NF1-ACACA	chr17	29422387	chr17	35518964	9	17	RFDEQIGM	TTCGACGAGCAGATTGGCATGGTA
NF1-ACACA	chr17	29422387	chr17	35518964	9	18	RFDEQIGMV	TTCGACGAGCAGATTGGCATGGTAGCT
NF1-ACACA	chr17	29422387	chr17	35518964	9	20	RFDEQIGMVAW	TTCGACGAGCAGATTGGCATGGTAGCTTGGAAA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NF1-ACACA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	NF1-ACACA	chr17	29422387	ENST00000356175	chr17	35518964	ENST00000335166	TCGA-E9-A1N6-01A

Top

Potential target of CAR-T therapy development for NF1-ACACA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NF1-ACACA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NF1-ACACA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	NF1	C0027831	Neurofibromatosis 1	44	CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	NF1	C1708353	Hereditary Paraganglioma-Pheochromocytoma Syndrome	10	CLINGEN
Hgene	NF1	C0349639	Juvenile Myelomonocytic Leukemia	7	CTD_human;GENOMICS_ENGLAND;ORPHANET
Hgene	NF1	C2931482	Neurofibromatosis-Noonan syndrome	6	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Hgene	NF1	C0553586	Cafe-au-lait macules with pulmonary stenosis	5	CTD_human;GENOMICS_ENGLAND;ORPHANET
Hgene	NF1	C0162678	Neurofibromatoses	3	CGI;CTD_human;GENOMICS_ENGLAND
Hgene	NF1	C0004114	Astrocytoma	2	CTD_human
Hgene	NF1	C0023467	Leukemia, Myelocytic, Acute	2	CTD_human
Hgene	NF1	C0025202	melanoma	2	CGI;CTD_human
Hgene	NF1	C0026998	Acute Myeloid Leukemia, M1	2	CTD_human
Hgene	NF1	C0205768	Subependymal Giant Cell Astrocytoma	2	CTD_human
Hgene	NF1	C0206727	Nerve Sheath Tumors	2	CTD_human
Hgene	NF1	C0280783	Juvenile Pilocytic Astrocytoma	2	CTD_human
Hgene	NF1	C0280785	Diffuse Astrocytoma	2	CTD_human
Hgene	NF1	C0334579	Anaplastic astrocytoma	2	CTD_human
Hgene	NF1	C0334580	Protoplasmic astrocytoma	2	CTD_human
Hgene	NF1	C0334581	Gemistocytic astrocytoma	2	CTD_human
Hgene	NF1	C0334582	Fibrillary Astrocytoma	2	CTD_human
Hgene	NF1	C0334583	Pilocytic Astrocytoma	2	CTD_human
Hgene	NF1	C0338070	Childhood Cerebral Astrocytoma	2	CTD_human
Hgene	NF1	C0547065	Mixed oligoastrocytoma	2	CTD_human
Hgene	NF1	C0750935	Cerebral Astrocytoma	2	CTD_human
Hgene	NF1	C0750936	Intracranial Astrocytoma	2	CTD_human
Hgene	NF1	C0751689	Peripheral Nerve Sheath Neoplasm	2	CTD_human
Hgene	NF1	C0751691	Perineurioma	2	CTD_human
Hgene	NF1	C1704230	Grade I Astrocytoma	2	CTD_human
Hgene	NF1	C1834235	NEUROFIBROMATOSIS, FAMILIAL SPINAL	2	CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	NF1	C1879321	Acute Myeloid Leukemia (AML-M2)	2	CTD_human
Hgene	NF1	C0001430	Adenoma	1	CTD_human
Hgene	NF1	C0004352	Autistic Disorder	1	CTD_human
Hgene	NF1	C0016057	Fibrosarcoma	1	CTD_human
Hgene	NF1	C0017636	Glioblastoma	1	CTD_human
Hgene	NF1	C0017638	Glioma	1	CGI;CTD_human
Hgene	NF1	C0020796	Profound Mental Retardation	1	CTD_human
Hgene	NF1	C0023186	Learning Disorders	1	CTD_human
Hgene	NF1	C0023827	liposarcoma	1	CTD_human
Hgene	NF1	C0025363	Mental Retardation, Psychosocial	1	CTD_human
Hgene	NF1	C0026654	Moyamoya Disease	1	GENOMICS_ENGLAND
Hgene	NF1	C0027809	Neurilemmoma	1	CTD_human
Hgene	NF1	C0027830	neurofibroma	1	CTD_human
Hgene	NF1	C0027962	Melanocytic nevus	1	CTD_human
Hgene	NF1	C0028326	Noonan Syndrome	1	GENOMICS_ENGLAND
Hgene	NF1	C0031511	Pheochromocytoma	1	CTD_human
Hgene	NF1	C0035320	Retinal Neovascularization	1	CTD_human
Hgene	NF1	C0205646	Adenoma, Basal Cell	1	CTD_human
Hgene	NF1	C0205647	Follicular adenoma	1	CTD_human
Hgene	NF1	C0205648	Adenoma, Microcystic	1	CTD_human
Hgene	NF1	C0205649	Adenoma, Monomorphic	1	CTD_human
Hgene	NF1	C0205650	Papillary adenoma	1	CTD_human
Hgene	NF1	C0205651	Adenoma, Trabecular	1	CTD_human
Hgene	NF1	C0205824	Liposarcoma, Dedifferentiated	1	CTD_human
Hgene	NF1	C0205825	Liposarcoma, Pleomorphic	1	CTD_human
Hgene	NF1	C0205944	Sarcoma, Epithelioid	1	CTD_human
Hgene	NF1	C0205945	Sarcoma, Spindle Cell	1	CTD_human
Hgene	NF1	C0259783	mixed gliomas	1	CTD_human
Hgene	NF1	C0334588	Giant Cell Glioblastoma	1	CTD_human
Hgene	NF1	C0555198	Malignant Glioma	1	CTD_human
Hgene	NF1	C0751262	Adult Learning Disorders	1	CTD_human
Hgene	NF1	C0751263	Learning Disturbance	1	CTD_human
Hgene	NF1	C0751265	Learning Disabilities	1	CTD_human
Hgene	NF1	C0751374	Schwannomatosis, Plexiform	1	CTD_human
Hgene	NF1	C0917816	Mental deficiency	1	CTD_human
Hgene	NF1	C0917817	Neurofibromatosis 3	1	CTD_human
Hgene	NF1	C1257877	Pheochromocytoma, Extra-Adrenal	1	CTD_human
Hgene	NF1	C1261473	Sarcoma	1	CTD_human
Hgene	NF1	C1330966	Developmental Academic Disorder	1	CTD_human
Hgene	NF1	C1370889	Liposarcoma, well differentiated	1	CTD_human
Hgene	NF1	C1621958	Glioblastoma Multiforme	1	CTD_human
Hgene	NF1	C3150928	NF1 Microdeletion Syndrome	1	ORPHANET
Hgene	NF1	C3714756	Intellectual Disability	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)