Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NFIC-UNC13A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NFIC-UNC13A
	FusionPDB ID: 58931
	FusionGDB2.0 ID: 58931
		Hgene	Tgene
	Gene symbol	NFIC	UNC13A
	Gene ID	4782	23025
	Gene name	nuclear factor I C	unc-13 homolog A
	Synonyms	CTF\|CTF5\|NF-I\|NFI	Munc13-1
	Cytomap	19p13.3	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	nuclear factor 1 C-typeCCAAT-box-binding transcription factorNF-I/CNF1-CTGGCA-binding proteinnuclear factor I/C (CCAAT-binding transcription factor)	protein unc-13 homolog A
	Modification date	20200313	20200313
	UniProtAcc	P08651 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000341919, ENST00000395111, ENST00000443272, ENST00000589123, ENST00000590282, ENST00000346156, ENST00000586919, ENST00000588839,	ENST00000252773, ENST00000428389, ENST00000519716, ENST00000550896, ENST00000551649, ENST00000552293,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	30 X 20 X 13=7800	11 X 13 X 6=858
	# samples	36	13
	** MAII score	log2(36/7800*10)=-4.4374053123073 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/858*10)=-2.72246602447109 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NFIC [Title/Abstract] AND UNC13A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NFIC [Title/Abstract] AND UNC13A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NFIC(3425175)-UNC13A(17722664), # samples:1
Anticipated loss of major functional domain due to fusion event.	NFIC-UNC13A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIC-UNC13A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIC-UNC13A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFIC-UNC13A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NFIC	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Hgene	NFIC	GO:0045944	positive regulation of transcription by RNA polymerase II	1524678\|19706729
Tgene	UNC13A	GO:1903861	positive regulation of dendrite extension	23999003

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:3425175/chr19:17722664)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NFIC (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across UNC13A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000589123	NFIC	chr19	3425175	-	ENST00000519716	UNC13A	chr19	17722664	-	6007	727	1880	0	627
ENST00000589123	NFIC	chr19	3425175	-	ENST00000252773	UNC13A	chr19	17722664	-	6006	727	1880	0	627
ENST00000589123	NFIC	chr19	3425175	-	ENST00000428389	UNC13A	chr19	17722664	-	6006	727	1880	0	627
ENST00000589123	NFIC	chr19	3425175	-	ENST00000551649	UNC13A	chr19	17722664	-	2014	727	1880	0	627
ENST00000589123	NFIC	chr19	3425175	-	ENST00000552293	UNC13A	chr19	17722664	-	1374	727	48	1280	410
ENST00000589123	NFIC	chr19	3425175	-	ENST00000550896	UNC13A	chr19	17722664	-	1284	727	48	1280	410
ENST00000395111	NFIC	chr19	3425175	-	ENST00000519716	UNC13A	chr19	17722664	-	5923	643	1796	0	599
ENST00000395111	NFIC	chr19	3425175	-	ENST00000252773	UNC13A	chr19	17722664	-	5922	643	1796	0	599
ENST00000395111	NFIC	chr19	3425175	-	ENST00000428389	UNC13A	chr19	17722664	-	5922	643	1796	0	599
ENST00000395111	NFIC	chr19	3425175	-	ENST00000551649	UNC13A	chr19	17722664	-	1930	643	1796	0	599
ENST00000395111	NFIC	chr19	3425175	-	ENST00000552293	UNC13A	chr19	17722664	-	1290	643	36	1196	386
ENST00000395111	NFIC	chr19	3425175	-	ENST00000550896	UNC13A	chr19	17722664	-	1200	643	36	1196	386
ENST00000341919	NFIC	chr19	3425175	-	ENST00000519716	UNC13A	chr19	17722664	-	6002	722	1875	1	625
ENST00000341919	NFIC	chr19	3425175	-	ENST00000252773	UNC13A	chr19	17722664	-	6001	722	1875	1	625
ENST00000341919	NFIC	chr19	3425175	-	ENST00000428389	UNC13A	chr19	17722664	-	6001	722	1875	1	625
ENST00000341919	NFIC	chr19	3425175	-	ENST00000551649	UNC13A	chr19	17722664	-	2009	722	1875	1	625
ENST00000341919	NFIC	chr19	3425175	-	ENST00000552293	UNC13A	chr19	17722664	-	1369	722	88	1275	395
ENST00000341919	NFIC	chr19	3425175	-	ENST00000550896	UNC13A	chr19	17722664	-	1279	722	88	1275	395
ENST00000590282	NFIC	chr19	3425175	-	ENST00000519716	UNC13A	chr19	17722664	-	5968	688	1841	0	614
ENST00000590282	NFIC	chr19	3425175	-	ENST00000252773	UNC13A	chr19	17722664	-	5967	688	1841	0	614
ENST00000590282	NFIC	chr19	3425175	-	ENST00000428389	UNC13A	chr19	17722664	-	5967	688	1841	0	614
ENST00000590282	NFIC	chr19	3425175	-	ENST00000551649	UNC13A	chr19	17722664	-	1975	688	1841	0	614
ENST00000590282	NFIC	chr19	3425175	-	ENST00000552293	UNC13A	chr19	17722664	-	1335	688	54	1241	395
ENST00000590282	NFIC	chr19	3425175	-	ENST00000550896	UNC13A	chr19	17722664	-	1245	688	54	1241	395
ENST00000443272	NFIC	chr19	3425175	-	ENST00000519716	UNC13A	chr19	17722664	-	5965	685	1838	0	613
ENST00000443272	NFIC	chr19	3425175	-	ENST00000252773	UNC13A	chr19	17722664	-	5964	685	1838	0	613
ENST00000443272	NFIC	chr19	3425175	-	ENST00000428389	UNC13A	chr19	17722664	-	5964	685	1838	0	613
ENST00000443272	NFIC	chr19	3425175	-	ENST00000551649	UNC13A	chr19	17722664	-	1972	685	1838	0	613
ENST00000443272	NFIC	chr19	3425175	-	ENST00000552293	UNC13A	chr19	17722664	-	1332	685	51	1238	395
ENST00000443272	NFIC	chr19	3425175	-	ENST00000550896	UNC13A	chr19	17722664	-	1242	685	51	1238	395

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000589123	ENST00000519716	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001495115	0.9985049
ENST00000589123	ENST00000252773	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001500716	0.9984993
ENST00000589123	ENST00000428389	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001500716	0.9984993
ENST00000589123	ENST00000551649	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.006723588	0.9932765
ENST00000589123	ENST00000552293	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.010985068	0.9890149
ENST00000589123	ENST00000550896	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.013442597	0.9865574
ENST00000395111	ENST00000519716	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001385799	0.9986142
ENST00000395111	ENST00000252773	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001390564	0.9986094
ENST00000395111	ENST00000428389	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001390564	0.9986094
ENST00000395111	ENST00000551649	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.005717286	0.9942827
ENST00000395111	ENST00000552293	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.009473088	0.9905269
ENST00000395111	ENST00000550896	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.011735026	0.98826504
ENST00000341919	ENST00000519716	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001587797	0.99841213
ENST00000341919	ENST00000252773	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001591996	0.998408
ENST00000341919	ENST00000428389	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001591996	0.998408
ENST00000341919	ENST00000551649	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.005403114	0.99459684
ENST00000341919	ENST00000552293	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.007894867	0.9921051
ENST00000341919	ENST00000550896	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.011109843	0.9888902
ENST00000590282	ENST00000519716	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001625352	0.9983746
ENST00000590282	ENST00000252773	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001629497	0.99837047
ENST00000590282	ENST00000428389	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001629497	0.99837047
ENST00000590282	ENST00000551649	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.005981563	0.99401844
ENST00000590282	ENST00000552293	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.009538996	0.99046093
ENST00000590282	ENST00000550896	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.013093485	0.9869065
ENST00000443272	ENST00000519716	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001640991	0.998359
ENST00000443272	ENST00000252773	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001645175	0.99835485
ENST00000443272	ENST00000428389	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.001645175	0.99835485
ENST00000443272	ENST00000551649	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.006290978	0.99370897
ENST00000443272	ENST00000552293	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.009975966	0.99002403
ENST00000443272	ENST00000550896	NFIC	chr19	3425175	-	UNC13A	chr19	17722664	-	0.013688643	0.9863114

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NFIC-UNC13A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NFIC	chr19	3425175	UNC13A	chr19	17722664	643	202	MGSDQEDSKPITLGLGVEDPVGEVSV
NFIC	chr19	3425175	UNC13A	chr19	17722664	685	211	MGSDQEDSKPITLGLGVEDPVGEVSV
NFIC	chr19	3425175	UNC13A	chr19	17722664	688	211	MGSDQEDSKPITLGLGVEDPVGEVSV
NFIC	chr19	3425175	UNC13A	chr19	17722664	722	211	MGSDQEDSKPITLGLGVEDPVGEVSV
NFIC	chr19	3425175	UNC13A	chr19	17722664	727	226	MGSDQEDSKPITLGLGVEDPVGEVSV

Top

Potential FusionNeoAntigen Information of NFIC-UNC13A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NFIC-UNC13A_3425175_17722664.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B14:01	DSKPITLGL	0.9971	0.7595	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B14:02	DSKPITLGL	0.9971	0.7595	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B81:01	KPITLGLGV	0.311	0.506	8	17
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B39:13	QEDSKPITLGL	0.9944	0.9421	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B54:01	KPITLGLGV	0.9685	0.6	8	17
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B51:07	DSKPITLGL	0.9672	0.6836	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B14:03	DSKPITLGL	0.8605	0.8376	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B42:01	KPITLGLGV	0.4262	0.8802	8	17
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B44:10	QEDSKPITLGL	0.9991	0.597	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B39:08	QEDSKPITLGL	0.9972	0.8673	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-A25:01	DSKPITLGL	0.9555	0.8056	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B55:04	KPITLGLGV	0.7705	0.5896	8	17
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-A69:01	DSKPITLGL	0.7219	0.5908	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B08:12	DSKPITLGL	0.6607	0.6491	6	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B67:01	KPITLGLGV	0.48	0.9655	8	17
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B40:04	QEDSKPITLGL	0.9991	0.6881	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B39:11	QEDSKPITLGL	0.997	0.7769	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B39:02	QEDSKPITLGL	0.9951	0.9404	4	15
NFIC-UNC13A	chr19	3425175	chr19	17722664	722	HLA-B41:03	QEDSKPITLGL	0.9886	0.6193	4	15

Top

Potential FusionNeoAntigen Information of NFIC-UNC13A in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NFIC-UNC13A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1407	DSKPITLGLGVEDP	NFIC	UNC13A	chr19	3425175	chr19	17722664	722

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NFIC-UNC13A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1407	DSKPITLGLGVEDP	-7.15543	-7.26883
HLA-B14:02	3BVN	1407	DSKPITLGLGVEDP	-4.77435	-5.80965
HLA-B52:01	3W39	1407	DSKPITLGLGVEDP	-6.80875	-6.92215
HLA-B52:01	3W39	1407	DSKPITLGLGVEDP	-4.20386	-5.23916
HLA-A11:01	4UQ2	1407	DSKPITLGLGVEDP	-7.5194	-8.5547
HLA-A11:01	4UQ2	1407	DSKPITLGLGVEDP	-6.9601	-7.0735
HLA-A24:02	5HGA	1407	DSKPITLGLGVEDP	-7.52403	-7.63743
HLA-A24:02	5HGA	1407	DSKPITLGLGVEDP	-5.82433	-6.85963
HLA-B27:05	6PYJ	1407	DSKPITLGLGVEDP	-3.28285	-4.31815
HLA-B44:05	3DX8	1407	DSKPITLGLGVEDP	-5.91172	-6.94702
HLA-B44:05	3DX8	1407	DSKPITLGLGVEDP	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of NFIC-UNC13A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NFIC-UNC13A	chr19	3425175	chr19	17722664	4	15	QEDSKPITLGL	AGGAGGACAGCAAGCCCATCACGCTGGGCTTGG
NFIC-UNC13A	chr19	3425175	chr19	17722664	6	15	DSKPITLGL	ACAGCAAGCCCATCACGCTGGGCTTGG
NFIC-UNC13A	chr19	3425175	chr19	17722664	8	17	KPITLGLGV	AGCCCATCACGCTGGGCTTGGGTGTAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NFIC-UNC13A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	NFIC-UNC13A	chr19	3425175	ENST00000341919	chr19	17722664	ENST00000550896	TCGA-DX-A8BL-01A

Top

Potential target of CAR-T therapy development for NFIC-UNC13A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NFIC-UNC13A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NFIC-UNC13A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)