Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NFIX-GATAD2A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NFIX-GATAD2A
	FusionPDB ID: 58946
	FusionGDB2.0 ID: 58946
		Hgene	Tgene
	Gene symbol	NFIX	GATAD2A
	Gene ID	4784	54815
	Gene name	nuclear factor I X	GATA zinc finger domain containing 2A
	Synonyms	CTF\|MRSHSS\|NF-I/X\|NF1-X\|NF1A\|SOTOS2	p66alpha
	Cytomap	19p13.13	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	nuclear factor 1 X-typeCCAAT-box-binding transcription factorTGGCA-binding proteinnuclear factor 1/X	transcriptional repressor p66-alphaGATA zinc finger domain-containing protein 2A
	Modification date	20200329	20200313
	UniProtAcc	Q14938 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.	Q86YP4 Main function of 5'-partner protein: FUNCTION: Transcriptional repressor. Enhances MBD2-mediated repression. Efficient repression requires the presence of GATAD2B. {ECO:0000269\|PubMed:12183469, ECO:0000269\|PubMed:16415179}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000358552, ENST00000360105, ENST00000397661, ENST00000585575, ENST00000587260, ENST00000587760, ENST00000588228, ENST00000592199, ENST00000588680,	ENST00000473184, ENST00000358713, ENST00000404158, ENST00000429563, ENST00000537887, ENST00000252577, ENST00000360315,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	27 X 14 X 16=6048	11 X 10 X 9=990
	# samples	42	14
	** MAII score	log2(42/6048*10)=-3.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/990*10)=-2.82200169802201 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NFIX [Title/Abstract] AND GATAD2A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NFIX [Title/Abstract] AND GATAD2A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NFIX(13184840)-GATAD2A(19603115), # samples:3
Anticipated loss of major functional domain due to fusion event.	NFIX-GATAD2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-GATAD2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-GATAD2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-GATAD2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NFIX	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Hgene	NFIX	GO:0045944	positive regulation of transcription by RNA polymerase II	19706729
Tgene	GATAD2A	GO:0045892	negative regulation of transcription, DNA-templated	12183469

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:13184840/chr19:19603115)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NFIX (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GATAD2A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000397661	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	6063	1048	173	2605	810
ENST00000397661	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	6138	1048	173	2680	835
ENST00000592199	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5833	818	0	2375	791
ENST00000592199	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5908	818	0	2450	816
ENST00000587760	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5850	835	14	2392	792
ENST00000587760	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5925	835	14	2467	817
ENST00000585575	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5809	794	0	2351	783
ENST00000585575	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5884	794	0	2426	808
ENST00000360105	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5907	892	65	2449	794
ENST00000360105	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5982	892	65	2524	819
ENST00000588228	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5910	895	53	2452	799
ENST00000588228	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5985	895	53	2527	824
ENST00000587260	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5888	873	58	2430	790
ENST00000587260	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5963	873	58	2505	815
ENST00000358552	NFIX	chr19	13184840	+	ENST00000252577	GATAD2A	chr19	19603115	+	5830	815	0	2372	790
ENST00000358552	NFIX	chr19	13184840	+	ENST00000360315	GATAD2A	chr19	19603115	+	5905	815	0	2447	815

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000397661	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004505655	0.99549437
ENST00000397661	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.003614909	0.9963851
ENST00000592199	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004017087	0.9959829
ENST00000592199	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.003207219	0.99679273
ENST00000587760	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.002987795	0.99701214
ENST00000587760	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.00261673	0.9973833
ENST00000585575	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.002878105	0.9971219
ENST00000585575	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.002520451	0.9974796
ENST00000360105	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.00522081	0.9947792
ENST00000360105	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004506701	0.9954933
ENST00000588228	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004706771	0.9952932
ENST00000588228	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.003750098	0.99624985
ENST00000587260	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004750166	0.99524987
ENST00000587260	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.00409027	0.9959097
ENST00000358552	ENST00000252577	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.004785224	0.9952148
ENST00000358552	ENST00000360315	NFIX	chr19	13184840	+	GATAD2A	chr19	19603115	+	0.00411545	0.9958845

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NFIX-GATAD2A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NFIX	chr19	13184840	GATAD2A	chr19	19603115	1048	291	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	794	264	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	815	271	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	818	272	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	835	273	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	873	271	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	892	275	TLGRRSITSPPSTSDMKSERRPPSPD
NFIX	chr19	13184840	GATAD2A	chr19	19603115	895	280	TLGRRSITSPPSTSDMKSERRPPSPD

Top

Potential FusionNeoAntigen Information of NFIX-GATAD2A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NFIX-GATAD2A_13184840_19603115.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A31:02	STSDMKSER	0.8247	0.5024	11	20
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-B15:17	ITSPPSTSDM	0.9903	0.7073	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-B15:16	ITSPPSTSDM	0.9782	0.58	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A11:03	ITSPPSTSDMK	0.9997	0.5593	6	17
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A03:12	ITSPPSTSDMK	0.9988	0.5436	6	17
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A30:08	ITSPPSTSDMK	0.9966	0.8101	6	17
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:17	TSPPSTSDM	0.722	0.9445	7	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:30	TSPPSTSDM	0.6324	0.964	7	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C03:08	ITSPPSTSDM	0.9963	0.7245	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C03:07	ITSPPSTSDM	0.9954	0.9507	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C15:06	ITSPPSTSDM	0.9934	0.9412	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:17	ITSPPSTSDM	0.9837	0.9329	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A11:01	ITSPPSTSDMK	0.9997	0.5207	6	17
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:03	TSPPSTSDM	0.7379	0.9388	7	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:02	TSPPSTSDM	0.7139	0.9428	7	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C03:06	TSPPSTSDM	0.6454	0.971	7	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C03:04	ITSPPSTSDM	0.9967	0.9436	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C03:03	ITSPPSTSDM	0.9967	0.9436	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-C01:02	ITSPPSTSDM	0.9848	0.9301	6	16
NFIX-GATAD2A	chr19	13184840	chr19	19603115	815	HLA-A11:02	ITSPPSTSDMK	0.9997	0.5207	6	17

Top

Potential FusionNeoAntigen Information of NFIX-GATAD2A in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NFIX-GATAD2A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4040	ITSPPSTSDMKSER	NFIX	GATAD2A	chr19	13184840	chr19	19603115	815

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NFIX-GATAD2A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4040	ITSPPSTSDMKSER	-7.15543	-7.26883
HLA-B14:02	3BVN	4040	ITSPPSTSDMKSER	-4.77435	-5.80965
HLA-B52:01	3W39	4040	ITSPPSTSDMKSER	-6.80875	-6.92215
HLA-B52:01	3W39	4040	ITSPPSTSDMKSER	-4.20386	-5.23916
HLA-A11:01	4UQ2	4040	ITSPPSTSDMKSER	-7.5194	-8.5547
HLA-A11:01	4UQ2	4040	ITSPPSTSDMKSER	-6.9601	-7.0735
HLA-A24:02	5HGA	4040	ITSPPSTSDMKSER	-7.52403	-7.63743
HLA-A24:02	5HGA	4040	ITSPPSTSDMKSER	-5.82433	-6.85963
HLA-B27:05	6PYJ	4040	ITSPPSTSDMKSER	-3.28285	-4.31815
HLA-B44:05	3DX8	4040	ITSPPSTSDMKSER	-5.91172	-6.94702
HLA-B44:05	3DX8	4040	ITSPPSTSDMKSER	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of NFIX-GATAD2A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NFIX-GATAD2A	chr19	13184840	chr19	19603115	11	20	STSDMKSER	CACCAGTGACATGAAGTCCGAGAGGAG
NFIX-GATAD2A	chr19	13184840	chr19	19603115	6	16	ITSPPSTSDM	CACCTCCCCTCCTTCCACCAGTGACATGAA
NFIX-GATAD2A	chr19	13184840	chr19	19603115	6	17	ITSPPSTSDMK	CACCTCCCCTCCTTCCACCAGTGACATGAAGTC
NFIX-GATAD2A	chr19	13184840	chr19	19603115	7	16	TSPPSTSDM	CTCCCCTCCTTCCACCAGTGACATGAA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NFIX-GATAD2A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
THCA	NFIX-GATAD2A	chr19	13184840	ENST00000358552	chr19	19603115	ENST00000252577	TCGA-FY-A2QD-01A

Top

Potential target of CAR-T therapy development for NFIX-GATAD2A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NFIX-GATAD2A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NFIX-GATAD2A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)