Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NLK-BCAS3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NLK-BCAS3
	FusionPDB ID: 59342
	FusionGDB2.0 ID: 59342
		Hgene	Tgene
	Gene symbol	NLK	BCAS3
	Gene ID	51701	54828
	Gene name	nemo like kinase	BCAS3 microtubule associated cell migration factor
	Synonyms	-	GAOB1\|MAAB
	Cytomap	17q11.2	17q23.2
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase NLK	breast carcinoma-amplified sequence 3BCAS4/BCAS3 fusionRudhirabreast carcinoma amplified sequence 4/3 fusion proteinmetastasis associated antigen of breast cancerprotein Maab1
	Modification date	20200313	20200313
	UniProtAcc	Q9UBE8 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase that regulates a number of transcription factors with key roles in cell fate determination. Positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Negative regulator of the canonical Wnt/beta-catenin signaling pathway. Binds to and phosphorylates TCF7L2/TCF4 and LEF1, promoting the dissociation of the TCF7L2/LEF1/beta-catenin complex from DNA, as well as the ubiquitination and subsequent proteolysis of LEF1. Together these effects inhibit the transcriptional activation of canonical Wnt/beta-catenin target genes. Negative regulator of the Notch signaling pathway. Binds to and phosphorylates NOTCH1, thereby preventing the formation of a transcriptionally active ternary complex of NOTCH1, RBPJ/RBPSUH and MAML1. Negative regulator of the MYB family of transcription factors. Phosphorylation of MYB leads to its subsequent proteolysis while phosphorylation of MYBL1 and MYBL2 inhibits their interaction with the coactivator CREBBP. Other transcription factors may also be inhibited by direct phosphorylation of CREBBP itself. Acts downstream of IL6 and MAP3K7/TAK1 to phosphorylate STAT3, which is in turn required for activation of NLK by MAP3K7/TAK1. Upon IL1B stimulus, cooperates with ATF5 to activate the transactivation activity of C/EBP subfamily members. Phosphorylates ATF5 but also stabilizes ATF5 protein levels in a kinase-independent manner (PubMed:25512613). {ECO:0000250\|UniProtKB:O54949, ECO:0000269\|PubMed:12482967, ECO:0000269\|PubMed:14960582, ECO:0000269\|PubMed:15004007, ECO:0000269\|PubMed:15764709, ECO:0000269\|PubMed:20061393, ECO:0000269\|PubMed:20118921, ECO:0000269\|PubMed:20874444, ECO:0000269\|PubMed:21454679, ECO:0000269\|PubMed:25512613}.	Q9H6U6 Main function of 5'-partner protein: FUNCTION: Plays a role in angiogenesis. Participates in the regulation of cell polarity and directional endothelial cell migration by mediating both the activation and recruitment of CDC42 and the reorganization of the actin cytoskeleton at the cell leading edge. Promotes filipodia formation (By similarity). Functions synergistically with PELP1 as a transcriptional coactivator of estrogen receptor-responsive genes. Stimulates histone acetyltransferase activity. Binds to chromatin. {ECO:0000250\|UniProtKB:Q8CCN5, ECO:0000269\|PubMed:17505058}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000407008, ENST00000582037, ENST00000583517,	ENST00000585812, ENST00000390652, ENST00000407086, ENST00000408905, ENST00000585744, ENST00000588462, ENST00000588874, ENST00000589222,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 10 X 9=1620	45 X 32 X 19=27360
	# samples	20	53
	** MAII score	log2(20/1620*10)=-3.01792190799726 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(53/27360*10)=-5.6899320603227 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NLK [Title/Abstract] AND BCAS3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NLK [Title/Abstract] AND BCAS3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NLK(26495683)-BCAS3(59067332), # samples:3
Anticipated loss of major functional domain due to fusion event.	NLK-BCAS3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NLK-BCAS3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NLK-BCAS3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NLK-BCAS3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NLK	GO:0050821	protein stabilization	25512613
Tgene	BCAS3	GO:0043085	positive regulation of catalytic activity	17505058
Tgene	BCAS3	GO:0045944	positive regulation of transcription by RNA polymerase II	17505058
Tgene	BCAS3	GO:0071391	cellular response to estrogen stimulus	17505058

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:26495683/chr17:59067332)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NLK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BCAS3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000407008	NLK	chr17	26495683	+	ENST00000589222	BCAS3	chr17	59067332	+	4149	1765	718	3330	870
ENST00000407008	NLK	chr17	26495683	+	ENST00000407086	BCAS3	chr17	59067332	+	3992	1765	718	3285	855
ENST00000407008	NLK	chr17	26495683	+	ENST00000390652	BCAS3	chr17	59067332	+	4044	1765	718	3330	870
ENST00000407008	NLK	chr17	26495683	+	ENST00000408905	BCAS3	chr17	59067332	+	4058	1765	718	3351	877
ENST00000407008	NLK	chr17	26495683	+	ENST00000588462	BCAS3	chr17	59067332	+	4103	1765	718	3396	892
ENST00000407008	NLK	chr17	26495683	+	ENST00000585744	BCAS3	chr17	59067332	+	3331	1765	718	3330	871
ENST00000407008	NLK	chr17	26495683	+	ENST00000588874	BCAS3	chr17	59067332	+	3991	1765	718	3285	855
ENST00000407008	NLK	chr17	26495683	+	ENST00000589222	BCAS3	chr17	59067331	+	4149	1765	718	3330	870
ENST00000407008	NLK	chr17	26495683	+	ENST00000407086	BCAS3	chr17	59067331	+	3992	1765	718	3285	855
ENST00000407008	NLK	chr17	26495683	+	ENST00000390652	BCAS3	chr17	59067331	+	4044	1765	718	3330	870
ENST00000407008	NLK	chr17	26495683	+	ENST00000408905	BCAS3	chr17	59067331	+	4058	1765	718	3351	877
ENST00000407008	NLK	chr17	26495683	+	ENST00000588462	BCAS3	chr17	59067331	+	4103	1765	718	3396	892
ENST00000407008	NLK	chr17	26495683	+	ENST00000585744	BCAS3	chr17	59067331	+	3331	1765	718	3330	871
ENST00000407008	NLK	chr17	26495683	+	ENST00000588874	BCAS3	chr17	59067331	+	3991	1765	718	3285	855

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000407008	ENST00000589222	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.003347081	0.9966529
ENST00000407008	ENST00000407086	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.004569407	0.9954306
ENST00000407008	ENST00000390652	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.003780122	0.99621993
ENST00000407008	ENST00000408905	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.003623329	0.9963767
ENST00000407008	ENST00000588462	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.00293669	0.99706334
ENST00000407008	ENST00000585744	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.004866114	0.9951338
ENST00000407008	ENST00000588874	NLK	chr17	26495683	+	BCAS3	chr17	59067332	+	0.004569679	0.99543035
ENST00000407008	ENST00000589222	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.003347081	0.9966529
ENST00000407008	ENST00000407086	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.004569407	0.9954306
ENST00000407008	ENST00000390652	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.003780122	0.99621993
ENST00000407008	ENST00000408905	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.003623329	0.9963767
ENST00000407008	ENST00000588462	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.00293669	0.99706334
ENST00000407008	ENST00000585744	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.004866114	0.9951338
ENST00000407008	ENST00000588874	NLK	chr17	26495683	+	BCAS3	chr17	59067331	+	0.004569679	0.99543035

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NLK-BCAS3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NLK	chr17	26495683	BCAS3	chr17	59067331	1765	349	RRILFQAQSPIQQVQDICFSHDCRWV
NLK	chr17	26495683	BCAS3	chr17	59067332	1765	349	RRILFQAQSPIQQVQDICFSHDCRWV

Top

Potential FusionNeoAntigen Information of NLK-BCAS3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NLK-BCAS3_26495683_59067331.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:02	AQSPIQQV	0.9971	0.9179	6	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:01	AQSPIQQV	0.9785	0.9718	6	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B52:01	AQSPIQQV	0.8932	0.9763	6	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B39:13	AQSPIQQV	0.7916	0.8503	6	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:02	QAQSPIQQV	0.8953	0.7598	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:01	QAQSPIQQV	0.8837	0.746	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B52:01	QAQSPIQQV	0.8773	0.9767	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B35:02	SPIQQVQDI	0.7286	0.6694	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B35:04	SPIQQVQDI	0.7286	0.6694	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:02	QAQSPIQQV	0.5586	0.9457	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:22	FQAQSPIQQV	0.994	0.6233	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:21	FQAQSPIQQV	0.9853	0.6344	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:60	FQAQSPIQQV	0.9808	0.5779	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:30	FQAQSPIQQV	0.98	0.5222	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:67	FQAQSPIQQV	0.98	0.5222	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:24	FQAQSPIQQV	0.98	0.5222	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:29	FQAQSPIQQV	0.9258	0.5261	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:02	FQAQSPIQQV	0.8118	0.9834	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:19	FQAQSPIQQV	0.7177	0.559	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:02	AQSPIQQVQDI	0.841	0.7702	6	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B13:01	AQSPIQQVQDI	0.7783	0.9237	6	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C03:07	QAQSPIQQV	0.9938	0.9623	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C15:06	QAQSPIQQV	0.986	0.8653	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C04:06	QAQSPIQQV	0.9774	0.9144	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C03:19	QAQSPIQQV	0.9171	0.9892	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C12:04	QAQSPIQQV	0.9091	0.9953	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C06:03	QAQSPIQQV	0.9006	0.995	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:07	QAQSPIQQV	0.8784	0.978	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C02:06	QAQSPIQQV	0.8673	0.9672	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:07	SPIQQVQDI	0.8499	0.5501	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C03:08	QAQSPIQQV	0.778	0.8455	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C12:12	QAQSPIQQV	0.7735	0.9771	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C08:04	QAQSPIQQV	0.7525	0.9888	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C08:13	QAQSPIQQV	0.7525	0.9888	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B35:12	SPIQQVQDI	0.7286	0.6694	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B15:05	IQQVQDICF	0.4631	0.8616	10	19
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C08:03	QAQSPIQQV	0.382	0.9904	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B42:02	SPIQQVQDI	0.1913	0.5256	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B39:10	SPIQQVQDI	0.1689	0.7469	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B42:01	SPIQQVQDI	0.1433	0.5213	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:05	FQAQSPIQQV	0.9949	0.7285	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:02	FQAQSPIQQV	0.9942	0.6306	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:01	FQAQSPIQQV	0.98	0.5222	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C02:06	FQAQSPIQQV	0.8832	0.987	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B15:73	AQSPIQQV	0.9865	0.9505	6	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C15:02	QAQSPIQQV	0.9948	0.8866	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C15:05	QAQSPIQQV	0.9919	0.8529	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C06:06	QAQSPIQQV	0.9662	0.9921	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C03:17	QAQSPIQQV	0.9515	0.9819	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:13	QAQSPIQQV	0.8888	0.5847	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:14	QAQSPIQQV	0.863	0.7312	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C16:02	QAQSPIQQV	0.8343	0.9908	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B15:53	IQQVQDICF	0.831	0.8275	10	19
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:05	QAQSPIQQV	0.8247	0.5357	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C03:06	QAQSPIQQV	0.8246	0.9906	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C06:17	QAQSPIQQV	0.8201	0.9952	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C06:02	QAQSPIQQV	0.8201	0.9952	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C17:01	QAQSPIQQV	0.8116	0.9881	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:21	QAQSPIQQV	0.811	0.7184	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C12:03	QAQSPIQQV	0.7624	0.9904	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:09	QAQSPIQQV	0.758	0.6978	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B35:09	SPIQQVQDI	0.7286	0.6694	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B51:29	QAQSPIQQV	0.7271	0.5249	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C06:08	QAQSPIQQV	0.7218	0.9938	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C16:04	QAQSPIQQV	0.658	0.9867	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B59:01	QAQSPIQQV	0.6565	0.6887	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A68:02	QAQSPIQQV	0.5981	0.6182	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B15:20	IQQVQDICF	0.4597	0.9159	10	19
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A69:01	QAQSPIQQV	0.4544	0.6416	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C16:01	QAQSPIQQV	0.4159	0.984	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B35:28	IQQVQDICF	0.4047	0.9214	10	19
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-C08:01	QAQSPIQQV	0.382	0.9904	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B07:13	QAQSPIQQV	0.3719	0.7918	5	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B48:02	IQQVQDICF	0.2957	0.9033	10	19
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B67:01	SPIQQVQDI	0.2252	0.6795	8	17
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:03	FQAQSPIQQV	0.9943	0.7535	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-B15:73	FQAQSPIQQV	0.9858	0.9925	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:14	FQAQSPIQQV	0.9857	0.6354	4	14
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	HLA-A02:06	FQAQSPIQQV	0.9853	0.6344	4	14

Top

Potential FusionNeoAntigen Information of NLK-BCAS3 in HLA II

NLK-BCAS3_26495683_59067331.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	DRB1-1001	RILFQAQSPIQQVQD	1	16
NLK-BCAS3	chr17	26495683	chr17	59067331	1765	DRB1-1003	RILFQAQSPIQQVQD	1	16

Top

Fusion breakpoint peptide structures of NLK-BCAS3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
531	AQSPIQQVQDICFS	NLK	BCAS3	chr17	26495683	chr17	59067331	1765

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NLK-BCAS3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	531	AQSPIQQVQDICFS	-7.9962	-8.1096
HLA-B14:02	3BVN	531	AQSPIQQVQDICFS	-5.70842	-6.74372
HLA-B52:01	3W39	531	AQSPIQQVQDICFS	-6.83737	-6.95077
HLA-B52:01	3W39	531	AQSPIQQVQDICFS	-4.4836	-5.5189
HLA-A11:01	4UQ2	531	AQSPIQQVQDICFS	-10.0067	-10.1201
HLA-A11:01	4UQ2	531	AQSPIQQVQDICFS	-9.03915	-10.0745
HLA-A24:02	5HGA	531	AQSPIQQVQDICFS	-6.56204	-6.67544
HLA-A24:02	5HGA	531	AQSPIQQVQDICFS	-5.42271	-6.45801
HLA-B44:05	3DX8	531	AQSPIQQVQDICFS	-7.85648	-8.89178
HLA-B44:05	3DX8	531	AQSPIQQVQDICFS	-5.3978	-5.5112
HLA-A02:01	6TDR	531	AQSPIQQVQDICFS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of NLK-BCAS3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NLK-BCAS3	chr17	26495683	chr17	59067331	10	19	IQQVQDICF	ATTCAGCAGGTACAGGACATCTGCTTC
NLK-BCAS3	chr17	26495683	chr17	59067331	4	14	FQAQSPIQQV	TTTCAGGCACAGAGTCCCATTCAGCAGGTA
NLK-BCAS3	chr17	26495683	chr17	59067331	5	14	QAQSPIQQV	CAGGCACAGAGTCCCATTCAGCAGGTA
NLK-BCAS3	chr17	26495683	chr17	59067331	6	14	AQSPIQQV	GCACAGAGTCCCATTCAGCAGGTA
NLK-BCAS3	chr17	26495683	chr17	59067331	6	17	AQSPIQQVQDI	GCACAGAGTCCCATTCAGCAGGTACAGGACATC
NLK-BCAS3	chr17	26495683	chr17	59067331	8	17	SPIQQVQDI	AGTCCCATTCAGCAGGTACAGGACATC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
NLK-BCAS3	chr17	26495683	chr17	59067331	1	16	RILFQAQSPIQQVQD	AGAATATTGTTTCAGGCACAGAGTCCCATTCAGCAGGTACAGGAC

Top

Information of the samples that have these potential fusion neoantigens of NLK-BCAS3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	NLK-BCAS3	chr17	26495683	ENST00000407008	chr17	59067331	ENST00000390652	TCGA-C8-A26X

Top

Potential target of CAR-T therapy development for NLK-BCAS3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NLK-BCAS3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NLK-BCAS3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)