|
|||||||
|
Fusion Protein:NOL9-PARK7 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: NOL9-PARK7 | FusionPDB ID: 59574 | FusionGDB2.0 ID: 59574 | Hgene | Tgene | Gene symbol | NOL9 | PARK7 | Gene ID | 79707 | 11315 |
| Gene name | nucleolar protein 9 | Parkinsonism associated deglycase | |
| Synonyms | Grc3|NET6 | DJ-1|DJ1|GATD2|HEL-S-67p | |
| Cytomap | 1p36.31 | 1p36.23 | |
| Type of gene | protein-coding | protein-coding | |
| Description | polynucleotide 5'-hydroxyl-kinase NOL9polynucleotide 5'-kinase | protein/nucleic acid deglycase DJ-1Parkinson disease (autosomal recessive, early onset) 7epididymis secretory sperm binding protein Li 67pmaillard deglycaseoncogene DJ1parkinson protein 7protein DJ-1protein deglycase DJ-1 | |
| Modification date | 20200313 | 20200327 | |
| UniProtAcc | Q5SY16 Main function of 5'-partner protein: FUNCTION: Polynucleotide 5'-kinase involved in rRNA processing. The kinase activity is required for the processing of the 32S precursor into 5.8S and 28S rRNAs, more specifically for the generation of the major 5.8S(S) form. In vitro, has both DNA and RNA 5'-kinase activities. Probably binds RNA. {ECO:0000269|PubMed:21063389}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000377705, | ENST00000497113, ENST00000338639, ENST00000377488, ENST00000377491, ENST00000377493, ENST00000493678, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 5 X 5 X 6=150 | 7 X 6 X 4=168 |
| # samples | 7 | 7 | |
| ** MAII score | log2(7/150*10)=-1.09953567355091 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: NOL9 [Title/Abstract] AND PARK7 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: NOL9 [Title/Abstract] AND PARK7 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NOL9(6610456)-PARK7(8037712), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | |||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | PARK7 | GO:0006281 | DNA repair | 28596309 |
| Tgene | PARK7 | GO:0006517 | protein deglycosylation | 25416785 |
| Tgene | PARK7 | GO:0006517 | protein deglycosylation | 27903648 |
| Tgene | PARK7 | GO:0009438 | methylglyoxal metabolic process | 22523093 |
| Tgene | PARK7 | GO:0009438 | methylglyoxal metabolic process | 27903648 |
| Tgene | PARK7 | GO:0010629 | negative regulation of gene expression | 22683601 |
| Tgene | PARK7 | GO:0019249 | lactate biosynthetic process | 22523093 |
| Tgene | PARK7 | GO:0031334 | positive regulation of protein complex assembly | 24947010 |
| Tgene | PARK7 | GO:0031397 | negative regulation of protein ubiquitination | 17015834|24899725 |
| Tgene | PARK7 | GO:0032091 | negative regulation of protein binding | 11477070|16731528|17015834|24899725 |
| Tgene | PARK7 | GO:0032435 | negative regulation of proteasomal ubiquitin-dependent protein catabolic process | 17015834 |
| Tgene | PARK7 | GO:0032757 | positive regulation of interleukin-8 production | 21097510 |
| Tgene | PARK7 | GO:0033234 | negative regulation of protein sumoylation | 16731528 |
| Tgene | PARK7 | GO:0034599 | cellular response to oxidative stress | 15983381|19703902|20969476|22683601 |
| Tgene | PARK7 | GO:0036471 | cellular response to glyoxal | 22523093 |
| Tgene | PARK7 | GO:0036526 | peptidyl-cysteine deglycation | 25416785 |
| Tgene | PARK7 | GO:0036527 | peptidyl-arginine deglycation | 25416785 |
| Tgene | PARK7 | GO:0036528 | peptidyl-lysine deglycation | 25416785 |
| Tgene | PARK7 | GO:0036529 | protein deglycation, glyoxal removal | 25416785 |
| Tgene | PARK7 | GO:0036530 | protein deglycation, methylglyoxal removal | 25416785 |
| Tgene | PARK7 | GO:0036530 | protein deglycation, methylglyoxal removal | 27903648 |
| Tgene | PARK7 | GO:0036531 | glutathione deglycation | 25416785 |
| Tgene | PARK7 | GO:0042743 | hydrogen peroxide metabolic process | 20969476|24567322 |
| Tgene | PARK7 | GO:0043066 | negative regulation of apoptotic process | 22523093 |
| Tgene | PARK7 | GO:0043523 | regulation of neuron apoptotic process | 18711745|20304780 |
| Tgene | PARK7 | GO:0043524 | negative regulation of neuron apoptotic process | 22511790 |
| Tgene | PARK7 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 21097510 |
| Tgene | PARK7 | GO:0046295 | glycolate biosynthetic process | 22523093 |
| Tgene | PARK7 | GO:0050821 | protein stabilization | 24947010 |
| Tgene | PARK7 | GO:0051444 | negative regulation of ubiquitin-protein transferase activity | 24899725 |
| Tgene | PARK7 | GO:0060548 | negative regulation of cell death | 14749723 |
| Tgene | PARK7 | GO:0060765 | regulation of androgen receptor signaling pathway | 11477070 |
| Tgene | PARK7 | GO:0070301 | cellular response to hydrogen peroxide | 14749723 |
| Tgene | PARK7 | GO:0106044 | guanine deglycation | 28596309 |
| Tgene | PARK7 | GO:0106045 | guanine deglycation, methylglyoxal removal | 28596309 |
| Tgene | PARK7 | GO:0106046 | guanine deglycation, glyoxal removal | 28596309 |
| Tgene | PARK7 | GO:1900182 | positive regulation of protein localization to nucleus | 21097510 |
| Tgene | PARK7 | GO:1901215 | negative regulation of neuron death | 22683601 |
| Tgene | PARK7 | GO:1901671 | positive regulation of superoxide dismutase activity | 24567322 |
| Tgene | PARK7 | GO:1901984 | negative regulation of protein acetylation | 22683601 |
| Tgene | PARK7 | GO:1903094 | negative regulation of protein K48-linked deubiquitination | 21097510 |
| Tgene | PARK7 | GO:1903168 | positive regulation of pyrroline-5-carboxylate reductase activity | 23743200 |
| Tgene | PARK7 | GO:1903178 | positive regulation of tyrosine 3-monooxygenase activity | 19703902 |
| Tgene | PARK7 | GO:1903181 | positive regulation of dopamine biosynthetic process | 19703902 |
| Tgene | PARK7 | GO:1903189 | glyoxal metabolic process | 22523093 |
| Tgene | PARK7 | GO:1903200 | positive regulation of L-dopa decarboxylase activity | 19703902 |
| Tgene | PARK7 | GO:1903202 | negative regulation of oxidative stress-induced cell death | 16632486 |
| Tgene | PARK7 | GO:1903208 | negative regulation of hydrogen peroxide-induced neuron death | 15983381|24947010 |
| Tgene | PARK7 | GO:1903377 | negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway | 15790595 |
| Tgene | PARK7 | GO:1905259 | negative regulation of nitrosative stress-induced intrinsic apoptotic signaling pathway | 14752510 |
| Tgene | PARK7 | GO:2000157 | negative regulation of ubiquitin-specific protease activity | 21097510 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:6610456/chr1:8037712) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across NOL9 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across PARK7 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000377705 | NOL9 | chr1 | 6610456 | - | ENST00000338639 | PARK7 | chr1 | 8037712 | + | 1122 | 649 | 33 | 896 | 287 |
| ENST00000377705 | NOL9 | chr1 | 6610456 | - | ENST00000493678 | PARK7 | chr1 | 8037712 | + | 1348 | 649 | 33 | 896 | 287 |
| ENST00000377705 | NOL9 | chr1 | 6610456 | - | ENST00000377493 | PARK7 | chr1 | 8037712 | + | 1124 | 649 | 33 | 896 | 287 |
| ENST00000377705 | NOL9 | chr1 | 6610456 | - | ENST00000377491 | PARK7 | chr1 | 8037712 | + | 1093 | 649 | 33 | 896 | 287 |
| ENST00000377705 | NOL9 | chr1 | 6610456 | - | ENST00000377488 | PARK7 | chr1 | 8037712 | + | 954 | 649 | 33 | 896 | 287 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000377705 | ENST00000338639 | NOL9 | chr1 | 6610456 | - | PARK7 | chr1 | 8037712 | + | 0.14738823 | 0.8526117 |
| ENST00000377705 | ENST00000493678 | NOL9 | chr1 | 6610456 | - | PARK7 | chr1 | 8037712 | + | 0.09511479 | 0.90488523 |
| ENST00000377705 | ENST00000377493 | NOL9 | chr1 | 6610456 | - | PARK7 | chr1 | 8037712 | + | 0.15138578 | 0.84861416 |
| ENST00000377705 | ENST00000377491 | NOL9 | chr1 | 6610456 | - | PARK7 | chr1 | 8037712 | + | 0.14790285 | 0.8520972 |
| ENST00000377705 | ENST00000377488 | NOL9 | chr1 | 6610456 | - | PARK7 | chr1 | 8037712 | + | 0.17123763 | 0.82876235 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NOL9-PARK7 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| NOL9 | chr1 | 6610456 | PARK7 | chr1 | 8037712 | 649 | 202 | ELKREARNLLKSHLNLGPTALLAHEI |
Top |
Potential FusionNeoAntigen Information of NOL9-PARK7 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| NOL9-PARK7_6610456_8037712.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:01 | LLKSHLNL | 0.9999 | 0.5868 | 8 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:04 | ARNLLKSHL | 0.9993 | 0.5648 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:05 | ARNLLKSHL | 0.9991 | 0.8157 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:06 | SHLNLGPTA | 0.9984 | 0.891 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:24 | SHLNLGPTA | 0.9979 | 0.6658 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:01 | SHLNLGPTA | 0.9976 | 0.9559 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:02 | SHLNLGPTA | 0.9972 | 0.9874 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:01 | NLLKSHLNL | 0.9884 | 0.7197 | 7 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:01 | ARNLLKSHL | 0.9862 | 0.595 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:02 | ARNLLKSHL | 0.9862 | 0.595 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:10 | SHLNLGPTA | 0.9848 | 0.5704 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:02 | ARNLLKSHL | 0.9701 | 0.9501 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:22 | HLNLGPTAL | 0.9627 | 0.5926 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:38 | HLNLGPTAL | 0.925 | 0.7092 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:13 | HLNLGPTAL | 0.9145 | 0.732 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:27 | HLNLGPTAL | 0.9011 | 0.6096 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:02 | HLNLGPTAL | 0.8883 | 0.9219 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:01 | HLNLGPTAL | 0.8883 | 0.9219 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:02 | HLNLGPTAL | 0.8466 | 0.9191 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:04 | NLLKSHLNL | 0.8075 | 0.6046 | 7 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:17 | HLNLGPTAL | 0.7465 | 0.5204 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:01 | HLNLGPTAL | 0.7339 | 0.7599 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:37 | SHLNLGPTA | 0.726 | 0.6719 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:09 | HLNLGPTAL | 0.6921 | 0.8135 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:18 | SHLNLGPTA | 0.6159 | 0.7883 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:10 | HLNLGPTAL | 0.603 | 0.5337 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:01 | HLNLGPTAL | 0.5981 | 0.9583 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:19 | NLLKSHLNL | 0.5708 | 0.5454 | 7 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B13:01 | HLNLGPTAL | 0.1536 | 0.906 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:24 | SHLNLGPTAL | 0.9992 | 0.5708 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:01 | SHLNLGPTAL | 0.9991 | 0.9458 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:06 | SHLNLGPTAL | 0.9988 | 0.8399 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:02 | SHLNLGPTAL | 0.9988 | 0.9748 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:01 | SHLNLGPTAL | 0.9985 | 0.9743 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:10 | SHLNLGPTAL | 0.9971 | 0.5694 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:02 | SHLNLGPTAL | 0.984 | 0.933 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:01 | SHLNLGPTAL | 0.984 | 0.933 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:18 | SHLNLGPTAL | 0.982 | 0.7159 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:37 | SHLNLGPTAL | 0.9746 | 0.6941 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:04 | ARNLLKSHLNL | 0.9999 | 0.6298 | 5 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:24 | SHLNLGPTALL | 0.9999 | 0.6188 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:01 | SHLNLGPTALL | 0.9998 | 0.9535 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:02 | SHLNLGPTALL | 0.9997 | 0.9792 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:01 | SHLNLGPTALL | 0.9996 | 0.9783 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:10 | SHLNLGPTALL | 0.9983 | 0.6326 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:37 | SHLNLGPTALL | 0.9856 | 0.7128 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:14 | ARNLLKSHL | 0.999 | 0.7291 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:09 | SHLNLGPTA | 0.9979 | 0.7292 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:05 | SHLNLGPTA | 0.9968 | 0.9424 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:95 | ARNLLKSHL | 0.9954 | 0.6399 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:05 | ARNLLKSHL | 0.9912 | 0.9598 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:12 | ARNLLKSHL | 0.9911 | 0.867 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C01:17 | HLNLGPTAL | 0.9848 | 0.945 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:03 | ARNLLKSHL | 0.9824 | 0.852 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C08:15 | HLNLGPTAL | 0.9793 | 0.9836 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:27 | ARNLLKSHL | 0.9771 | 0.9331 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:29 | ARNLLKSHL | 0.9721 | 0.9302 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:04 | HLNLGPTAL | 0.9493 | 0.8952 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:46 | ARNLLKSHL | 0.9493 | 0.8162 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:13 | ARNLLKSHL | 0.9439 | 0.8696 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C04:14 | HLNLGPTAL | 0.9229 | 0.9189 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C08:04 | HLNLGPTAL | 0.9223 | 0.9852 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C08:13 | HLNLGPTAL | 0.9223 | 0.9852 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:67 | ARNLLKSHL | 0.9058 | 0.9147 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:80 | ARNLLKSHL | 0.9058 | 0.9147 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:19 | ARNLLKSHL | 0.8911 | 0.5308 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:10 | ARNLLKSHL | 0.8651 | 0.9427 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:03 | HLNLGPTAL | 0.8623 | 0.8776 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:21 | HLNLGPTAL | 0.8512 | 0.9104 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:08 | HLNLGPTAL | 0.7804 | 0.9571 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C01:30 | HLNLGPTAL | 0.6449 | 0.9674 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:10 | HLNLGPTAL | 0.633 | 0.9601 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:12 | HLNLGPTAL | 0.6264 | 0.9616 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:09 | HLNLGPTAL | 0.6156 | 0.7144 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:03 | ARNLLKSHL | 0.4012 | 0.6957 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B73:01 | SHLNLGPTA | 0.3171 | 0.8502 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C12:16 | ARNLLKSHL | 0.0174 | 0.9637 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:09 | SHLNLGPTAL | 0.9991 | 0.6566 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:12 | SHLNLGPTAL | 0.9989 | 0.9513 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:05 | SHLNLGPTAL | 0.9987 | 0.9281 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B14:03 | SHLNLGPTAL | 0.9167 | 0.8582 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:09 | SHLNLGPTALL | 0.9998 | 0.6876 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:05 | SHLNLGPTALL | 0.9997 | 0.9359 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:03 | ARNLLKSHLNL | 0.9985 | 0.8615 | 5 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:18 | LLKSHLNL | 0.9999 | 0.5868 | 8 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:12 | LLKSHLNL | 0.9565 | 0.7451 | 8 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:10 | ARNLLKSHL | 0.9993 | 0.7708 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:06 | ARNLLKSHL | 0.9993 | 0.55 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:08 | ARNLLKSHL | 0.9991 | 0.6278 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:09 | ARNLLKSHL | 0.999 | 0.7956 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:31 | SHLNLGPTA | 0.9978 | 0.9565 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:01 | ARNLLKSHL | 0.9959 | 0.5472 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:31 | ARNLLKSHL | 0.9927 | 0.8626 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:09 | SHLNLGPTA | 0.9902 | 0.8177 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:18 | NLLKSHLNL | 0.9884 | 0.7197 | 7 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C01:02 | HLNLGPTAL | 0.9855 | 0.9462 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C18:01 | HLNLGPTAL | 0.9848 | 0.9082 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C01:03 | HLNLGPTAL | 0.9822 | 0.9304 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C08:02 | HLNLGPTAL | 0.9793 | 0.9836 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C03:03 | HLNLGPTAL | 0.9662 | 0.9709 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C03:04 | HLNLGPTAL | 0.9662 | 0.9709 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C06:08 | ARNLLKSHL | 0.9605 | 0.9772 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-A02:03 | HLNLGPTAL | 0.9596 | 0.6898 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C03:67 | HLNLGPTAL | 0.9538 | 0.9582 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:73 | HLNLGPTAL | 0.943 | 0.9232 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B07:13 | HLNLGPTAL | 0.916 | 0.7353 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:02 | ARNLLKSHL | 0.9058 | 0.9147 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C03:06 | HLNLGPTAL | 0.9018 | 0.9787 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:30 | HLNLGPTAL | 0.8671 | 0.9388 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:04 | ARNLLKSHL | 0.8644 | 0.9465 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:11 | SHLNLGPTA | 0.7988 | 0.8599 | 11 | 20 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:22 | ARNLLKSHL | 0.788 | 0.7538 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:11 | HLNLGPTAL | 0.7659 | 0.9422 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C07:04 | HLNLGPTAL | 0.7531 | 0.953 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:12 | HLNLGPTAL | 0.7451 | 0.8866 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:18 | HLNLGPTAL | 0.7339 | 0.7599 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C17:01 | HLNLGPTAL | 0.66 | 0.9095 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B08:12 | NLLKSHLNL | 0.637 | 0.92 | 7 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:02 | HLNLGPTAL | 0.6333 | 0.9675 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:31 | HLNLGPTAL | 0.6179 | 0.9584 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B35:13 | HLNLGPTAL | 0.5458 | 0.8918 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:09 | HLNLGPTAL | 0.3897 | 0.6097 | 12 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C06:06 | ARNLLKSHL | 0.2362 | 0.9882 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C06:02 | ARNLLKSHL | 0.034 | 0.9912 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-C06:17 | ARNLLKSHL | 0.034 | 0.9912 | 5 | 14 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:31 | SHLNLGPTAL | 0.9992 | 0.9489 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:02 | SHLNLGPTAL | 0.9991 | 0.9526 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:05 | SHLNLGPTAL | 0.9985 | 0.9743 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:09 | SHLNLGPTAL | 0.9956 | 0.6903 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:11 | SHLNLGPTAL | 0.9724 | 0.8252 | 11 | 21 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:06 | ARNLLKSHLNL | 0.9999 | 0.6312 | 5 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:31 | SHLNLGPTALL | 0.9999 | 0.956 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B27:09 | ARNLLKSHLNL | 0.9998 | 0.8138 | 5 | 16 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B38:05 | SHLNLGPTALL | 0.9996 | 0.9783 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B15:09 | SHLNLGPTALL | 0.9976 | 0.7193 | 11 | 22 |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 | HLA-B39:11 | SHLNLGPTALL | 0.9935 | 0.8274 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of NOL9-PARK7 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NOL9-PARK7 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 8056 | RNLLKSHLNLGPTA | NOL9 | PARK7 | chr1 | 6610456 | chr1 | 8037712 | 649 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NOL9-PARK7 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 8056 | RNLLKSHLNLGPTA | -5.86293 | -5.97633 |
| HLA-B14:02 | 3BVN | 8056 | RNLLKSHLNLGPTA | -4.7505 | -5.7858 |
| HLA-B52:01 | 3W39 | 8056 | RNLLKSHLNLGPTA | -7.16929 | -7.28269 |
| HLA-B52:01 | 3W39 | 8056 | RNLLKSHLNLGPTA | -6.22817 | -7.26347 |
| HLA-A11:01 | 4UQ2 | 8056 | RNLLKSHLNLGPTA | 10001 | 10000 |
| HLA-A24:02 | 5HGA | 8056 | RNLLKSHLNLGPTA | -7.90199 | -8.01539 |
| HLA-A24:02 | 5HGA | 8056 | RNLLKSHLNLGPTA | -7.88373 | -8.91903 |
| HLA-B44:05 | 3DX8 | 8056 | RNLLKSHLNLGPTA | -5.57367 | -5.68707 |
| HLA-B44:05 | 3DX8 | 8056 | RNLLKSHLNLGPTA | -4.76642 | -5.80172 |
Top |
Vaccine Design for the FusionNeoAntigens of NOL9-PARK7 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 11 | 20 | SHLNLGPTA | ACCTTGGTCCTACTGCTCTGTTGGCTC |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 11 | 21 | SHLNLGPTAL | ACCTTGGTCCTACTGCTCTGTTGGCTCATG |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 11 | 22 | SHLNLGPTALL | ACCTTGGTCCTACTGCTCTGTTGGCTCATGAAA |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 12 | 21 | HLNLGPTAL | TTGGTCCTACTGCTCTGTTGGCTCATG |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 5 | 14 | ARNLLKSHL | TGCTCAAATCTCATCTTAACCTTGGTC |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 5 | 16 | ARNLLKSHLNL | TGCTCAAATCTCATCTTAACCTTGGTCCTACTG |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 7 | 16 | NLLKSHLNL | AATCTCATCTTAACCTTGGTCCTACTG |
| NOL9-PARK7 | chr1 | 6610456 | chr1 | 8037712 | 8 | 16 | LLKSHLNL | CTCATCTTAACCTTGGTCCTACTG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NOL9-PARK7 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| Non-Cancer | NOL9-PARK7 | chr1 | 6610456 | ENST00000377705 | chr1 | 8037712 | ENST00000338639 | TCGA-CG-5720-11A |
Top |
Potential target of CAR-T therapy development for NOL9-PARK7 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NOL9-PARK7 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NOL9-PARK7 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies