![]() |
|||||||
|
Fusion Protein:ARHGAP32-AHNAK |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ARHGAP32-AHNAK | FusionPDB ID: 6067 | FusionGDB2.0 ID: 6067 | Hgene | Tgene | Gene symbol | ARHGAP32 | AHNAK | Gene ID | 9743 | 79026 |
Gene name | Rho GTPase activating protein 32 | AHNAK nucleoprotein | |
Synonyms | GC-GAP|GRIT|PX-RICS|RICS|p200RhoGAP|p250GAP | AHNAKRS|PM227 | |
Cytomap | 11q24.3 | 11q12.3 | |
Type of gene | protein-coding | protein-coding | |
Description | rho GTPase-activating protein 32GAB-associated CDC42GAB-associated Cdc42/Rac GTPase-activating proteinGTPase regulator interacting with TrkAGTPase-activating protein for Cdc42 and Rac1RhoGAP involved in the -catenin-N-cadherin and NMDA receptor signa | neuroblast differentiation-associated protein AHNAKAHNAK-relateddesmoyokin | |
Modification date | 20200327 | 20200327 | |
UniProtAcc | A7KAX9 Main function of 5'-partner protein: FUNCTION: GTPase-activating protein (GAP) promoting GTP hydrolysis on RHOA, CDC42 and RAC1 small GTPases. May be involved in the differentiation of neuronal cells during the formation of neurite extensions. Involved in NMDA receptor activity-dependent actin reorganization in dendritic spines. May mediate cross-talks between Ras- and Rho-regulated signaling pathways in cell growth regulation. Isoform 2 has higher GAP activity (By similarity). {ECO:0000250, ECO:0000269|PubMed:12446789, ECO:0000269|PubMed:12454018, ECO:0000269|PubMed:12531901, ECO:0000269|PubMed:12788081, ECO:0000269|PubMed:12819203, ECO:0000269|PubMed:12857875, ECO:0000269|PubMed:17663722}. | Q8IVF2 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000310343, ENST00000524655, ENST00000392657, ENST00000527272, | ENST00000525875, ENST00000378024, ENST00000257247, ENST00000530124, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 9 X 5=450 | 24 X 16 X 9=3456 |
# samples | 11 | 32 | |
** MAII score | log2(11/450*10)=-2.03242147769238 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(32/3456*10)=-3.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ARHGAP32 [Title/Abstract] AND AHNAK [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ARHGAP32 [Title/Abstract] AND AHNAK [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ARHGAP32(128993341)-AHNAK(62201363), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | ARHGAP32-AHNAK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARHGAP32-AHNAK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARHGAP32-AHNAK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARHGAP32-AHNAK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARHGAP32-AHNAK seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ARHGAP32-AHNAK seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:128993341/chr11:62201363) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000310343 | ARHGAP32 | chr11 | 128993341 | - | ENST00000530124 | AHNAK | chr11 | 62201363 | - | 750 | 402 | 0 | 455 | 151 |
ENST00000524655 | ARHGAP32 | chr11 | 128993341 | - | ENST00000530124 | AHNAK | chr11 | 62201363 | - | 552 | 204 | 550 | 278 | 90 |
ENST00000310343 | ARHGAP32 | chr11 | 128993340 | - | ENST00000530124 | AHNAK | chr11 | 62201363 | - | 750 | 402 | 0 | 455 | 151 |
ENST00000524655 | ARHGAP32 | chr11 | 128993340 | - | ENST00000530124 | AHNAK | chr11 | 62201363 | - | 552 | 204 | 550 | 278 | 90 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000310343 | ENST00000530124 | ARHGAP32 | chr11 | 128993341 | - | AHNAK | chr11 | 62201363 | - | 0.004108038 | 0.9958919 |
ENST00000524655 | ENST00000530124 | ARHGAP32 | chr11 | 128993341 | - | AHNAK | chr11 | 62201363 | - | 0.437616 | 0.562384 |
ENST00000310343 | ENST00000530124 | ARHGAP32 | chr11 | 128993340 | - | AHNAK | chr11 | 62201363 | - | 0.004108038 | 0.9958919 |
ENST00000524655 | ENST00000530124 | ARHGAP32 | chr11 | 128993340 | - | AHNAK | chr11 | 62201363 | - | 0.437616 | 0.562384 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ARHGAP32-AHNAK |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ARHGAP32 | chr11 | 128993340 | AHNAK | chr11 | 62201363 | 402 | 133 | AHFHYENVEFGSIQDCRSGQEENHPL |
ARHGAP32 | chr11 | 128993341 | AHNAK | chr11 | 62201363 | 402 | 133 | AHFHYENVEFGSIQDCRSGQEENHPL |
Top |
Potential FusionNeoAntigen Information of ARHGAP32-AHNAK in HLA I |
![]() |
ARHGAP32-AHNAK_128993340_62201363.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ARHGAP32-AHNAK | chr11 | 128993340 | chr11 | 62201363 | 402 | HLA-B50:01 | VEFGSIQDC | 0.0951 | 0.6531 | 7 | 16 |
ARHGAP32-AHNAK | chr11 | 128993340 | chr11 | 62201363 | 402 | HLA-B50:05 | VEFGSIQDC | 0.0951 | 0.6531 | 7 | 16 |
ARHGAP32-AHNAK | chr11 | 128993340 | chr11 | 62201363 | 402 | HLA-B50:04 | VEFGSIQDC | 0.0951 | 0.6531 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of ARHGAP32-AHNAK in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ARHGAP32-AHNAK |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6431 | NVEFGSIQDCRSGQ | ARHGAP32 | AHNAK | chr11 | 128993340 | chr11 | 62201363 | 402 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARHGAP32-AHNAK |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6431 | NVEFGSIQDCRSGQ | -7.29174 | -7.40514 |
HLA-B14:02 | 3BVN | 6431 | NVEFGSIQDCRSGQ | -4.74919 | -5.78449 |
HLA-B52:01 | 3W39 | 6431 | NVEFGSIQDCRSGQ | -5.07451 | -5.18791 |
HLA-B52:01 | 3W39 | 6431 | NVEFGSIQDCRSGQ | -2.86294 | -3.89824 |
HLA-A11:01 | 4UQ2 | 6431 | NVEFGSIQDCRSGQ | -4.62205 | -5.65735 |
HLA-A24:02 | 5HGA | 6431 | NVEFGSIQDCRSGQ | -11.701 | -11.8144 |
HLA-A24:02 | 5HGA | 6431 | NVEFGSIQDCRSGQ | -4.6967 | -5.732 |
HLA-B44:05 | 3DX8 | 6431 | NVEFGSIQDCRSGQ | -5.76162 | -5.87502 |
HLA-B44:05 | 3DX8 | 6431 | NVEFGSIQDCRSGQ | -3.98447 | -5.01977 |
HLA-A02:01 | 6TDR | 6431 | NVEFGSIQDCRSGQ | -2.29826 | -3.33356 |
Top |
Vaccine Design for the FusionNeoAntigens of ARHGAP32-AHNAK |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ARHGAP32-AHNAK | chr11 | 128993340 | chr11 | 62201363 | 7 | 16 | VEFGSIQDC | GAGTTCGGCAGCATACAGGACTGTAGA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ARHGAP32-AHNAK |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | ARHGAP32-AHNAK | chr11 | 128993340 | ENST00000310343 | chr11 | 62201363 | ENST00000530124 | TCGA-A8-A06Z |
Top |
Potential target of CAR-T therapy development for ARHGAP32-AHNAK |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ARHGAP32-AHNAK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ARHGAP32-AHNAK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | ARHGAP32 | C0036341 | Schizophrenia | 1 | PSYGENET |