![]() |
|||||||
|
Fusion Protein:NTRK3-PEAK1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: NTRK3-PEAK1 | FusionPDB ID: 60712 | FusionGDB2.0 ID: 60712 | Hgene | Tgene | Gene symbol | NTRK3 | PEAK1 | Gene ID | 4916 | 79834 |
Gene name | neurotrophic receptor tyrosine kinase 3 | pseudopodium enriched atypical kinase 1 | |
Synonyms | GP145-TrkC|TRKC|gp145(trkC) | SGK269 | |
Cytomap | 15q25.3 | 15q24.3 | |
Type of gene | protein-coding | protein-coding | |
Description | NT-3 growth factor receptorETS related protein-neurotrophic receptor tyrosine kinase fusion proteinETV6-NTRK3 fusionneurotrophic tyrosine kinase, receptor, type 3tyrosine kinase receptor C | inactive tyrosine-protein kinase PEAK1NKF3 kinase family membersugen kinase 269tyrosine-protein kinase SgK269 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q16288 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase involved in nervous system and probably heart development. Upon binding of its ligand NTF3/neurotrophin-3, NTRK3 autophosphorylates and activates different signaling pathways, including the phosphatidylinositol 3-kinase/AKT and the MAPK pathways, that control cell survival and differentiation. {ECO:0000269|PubMed:25196463}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000317501, ENST00000355254, ENST00000357724, ENST00000360948, ENST00000394480, ENST00000540489, ENST00000542733, ENST00000557856, ENST00000558676, ENST00000558306, | ENST00000312493, ENST00000558305, ENST00000567337, ENST00000560626, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 15 X 5=900 | 8 X 7 X 5=280 |
# samples | 17 | 8 | |
** MAII score | log2(17/900*10)=-2.40439025507934 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/280*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: NTRK3 [Title/Abstract] AND PEAK1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: NTRK3 [Title/Abstract] AND PEAK1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NTRK3(88726649)-PEAK1(77407661), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. NTRK3-PEAK1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | NTRK3 | GO:0000187 | activation of MAPK activity | 23027130 |
Hgene | NTRK3 | GO:0001933 | negative regulation of protein phosphorylation | 23027130 |
Hgene | NTRK3 | GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | 23027130 |
Hgene | NTRK3 | GO:0008284 | positive regulation of cell proliferation | 23027130 |
Hgene | NTRK3 | GO:0010628 | positive regulation of gene expression | 23027130 |
Hgene | NTRK3 | GO:0030335 | positive regulation of cell migration | 23027130 |
Hgene | NTRK3 | GO:0032148 | activation of protein kinase B activity | 23027130 |
Hgene | NTRK3 | GO:0033138 | positive regulation of peptidyl-serine phosphorylation | 23027130 |
Hgene | NTRK3 | GO:0050927 | positive regulation of positive chemotaxis | 23027130 |
Hgene | NTRK3 | GO:0090630 | activation of GTPase activity | 23027130 |
Hgene | NTRK3 | GO:2000251 | positive regulation of actin cytoskeleton reorganization | 23027130 |
Tgene | PEAK1 | GO:0016477 | cell migration | 20534451 |
Tgene | PEAK1 | GO:0034446 | substrate adhesion-dependent cell spreading | 20534451 |
Tgene | PEAK1 | GO:0046777 | protein autophosphorylation | 20534451 |
Tgene | PEAK1 | GO:0051893 | regulation of focal adhesion assembly | 23105102 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:88726649/chr15:77407661) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000557856 | NTRK3 | chr15 | 88726649 | - | ENST00000560626 | PEAK1 | chr15 | 77407661 | - | 7581 | 419 | 155 | 1582 | 475 |
ENST00000558676 | NTRK3 | chr15 | 88726649 | - | ENST00000560626 | PEAK1 | chr15 | 77407661 | - | 7583 | 421 | 157 | 1584 | 475 |
ENST00000540489 | NTRK3 | chr15 | 88726649 | - | ENST00000560626 | PEAK1 | chr15 | 77407661 | - | 7563 | 401 | 137 | 1564 | 475 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000557856 | ENST00000560626 | NTRK3 | chr15 | 88726649 | - | PEAK1 | chr15 | 77407661 | - | 0.002829617 | 0.9971704 |
ENST00000558676 | ENST00000560626 | NTRK3 | chr15 | 88726649 | - | PEAK1 | chr15 | 77407661 | - | 0.002828164 | 0.9971718 |
ENST00000540489 | ENST00000560626 | NTRK3 | chr15 | 88726649 | - | PEAK1 | chr15 | 77407661 | - | 0.002773898 | 0.99722606 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NTRK3-PEAK1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
NTRK3 | chr15 | 88726649 | PEAK1 | chr15 | 77407661 | 401 | 88 | AQSLCQEPPFALYICKSKAKESQQYY |
NTRK3 | chr15 | 88726649 | PEAK1 | chr15 | 77407661 | 419 | 88 | AQSLCQEPPFALYICKSKAKESQQYY |
NTRK3 | chr15 | 88726649 | PEAK1 | chr15 | 77407661 | 421 | 88 | AQSLCQEPPFALYICKSKAKESQQYY |
Top |
Potential FusionNeoAntigen Information of NTRK3-PEAK1 in HLA I |
![]() |
NTRK3-PEAK1_88726649_77407661.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B13:02 | QEPPFALYI | 0.9904 | 0.509 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B50:02 | QEPPFALYI | 0.9702 | 0.6321 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B44:03 | QEPPFALYI | 0.9661 | 0.971 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B13:01 | QEPPFALYI | 0.9593 | 0.9371 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B45:01 | QEPPFALYI | 0.9461 | 0.9627 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B47:01 | QEPPFALYI | 0.901 | 0.6461 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B41:01 | QEPPFALYI | 0.4606 | 0.9841 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B52:01 | QEPPFALYI | 0.3605 | 0.8691 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B39:13 | QEPPFALYI | 0.2715 | 0.9798 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B51:07 | QEPPFALYI | 0.4088 | 0.7931 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B40:04 | QEPPFALYI | 0.9746 | 0.7334 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B44:26 | QEPPFALYI | 0.9661 | 0.971 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B44:13 | QEPPFALYI | 0.9661 | 0.971 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B44:07 | QEPPFALYI | 0.9661 | 0.971 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B18:08 | QEPPFALYI | 0.6228 | 0.9564 | 5 | 14 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | HLA-B41:03 | QEPPFALYI | 0.5396 | 0.7588 | 5 | 14 |
Top |
Potential FusionNeoAntigen Information of NTRK3-PEAK1 in HLA II |
![]() |
NTRK3-PEAK1_88726649_77407661.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1111 | FALYICKSKAKESQQ | 9 | 24 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1338 | FALYICKSKAKESQQ | 9 | 24 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1338 | PFALYICKSKAKESQ | 8 | 23 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1363 | FALYICKSKAKESQQ | 9 | 24 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1365 | FALYICKSKAKESQQ | 9 | 24 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1365 | PFALYICKSKAKESQ | 8 | 23 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1463 | FALYICKSKAKESQQ | 9 | 24 |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 | DRB1-1485 | FALYICKSKAKESQQ | 9 | 24 |
Top |
Fusion breakpoint peptide structures of NTRK3-PEAK1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2018 | EPPFALYICKSKAK | NTRK3 | PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 401 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NTRK3-PEAK1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2018 | EPPFALYICKSKAK | -4.93023 | -5.69623 |
HLA-B14:02 | 3BVN | 2018 | EPPFALYICKSKAK | -4.03623 | -4.22633 |
HLA-B52:01 | 3W39 | 2018 | EPPFALYICKSKAK | -6.76045 | -6.95055 |
HLA-B52:01 | 3W39 | 2018 | EPPFALYICKSKAK | -4.82304 | -5.58904 |
HLA-A11:01 | 4UQ2 | 2018 | EPPFALYICKSKAK | -6.12244 | -6.88844 |
HLA-A24:02 | 5HGA | 2018 | EPPFALYICKSKAK | -6.83882 | -7.60482 |
HLA-A24:02 | 5HGA | 2018 | EPPFALYICKSKAK | -5.32749 | -5.51759 |
HLA-B44:05 | 3DX8 | 2018 | EPPFALYICKSKAK | -7.07991 | -7.84591 |
HLA-B44:05 | 3DX8 | 2018 | EPPFALYICKSKAK | -6.27909 | -6.46919 |
HLA-A02:01 | 6TDR | 2018 | EPPFALYICKSKAK | -3.83325 | -4.59925 |
Top |
Vaccine Design for the FusionNeoAntigens of NTRK3-PEAK1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 5 | 14 | QEPPFALYI | CAAGAACCCCCATTTGCGTTATATATC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 8 | 23 | PFALYICKSKAKESQ | CCATTTGCGTTATATATCTGTAAGAGCAAAGCTAAAGAATCTCAG |
NTRK3-PEAK1 | chr15 | 88726649 | chr15 | 77407661 | 9 | 24 | FALYICKSKAKESQQ | TTTGCGTTATATATCTGTAAGAGCAAAGCTAAAGAATCTCAGCAG |
Top |
Information of the samples that have these potential fusion neoantigens of NTRK3-PEAK1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LGG | NTRK3-PEAK1 | chr15 | 88726649 | ENST00000540489 | chr15 | 77407661 | ENST00000560626 | TCGA-TM-A7CF-01A |
Top |
Potential target of CAR-T therapy development for NTRK3-PEAK1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NTRK3-PEAK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NTRK3-PEAK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | NTRK3 | C0036341 | Schizophrenia | 3 | PSYGENET |
Hgene | NTRK3 | C0041696 | Unipolar Depression | 2 | PSYGENET |
Hgene | NTRK3 | C1269683 | Major Depressive Disorder | 2 | PSYGENET |
Hgene | NTRK3 | C1332965 | Congenital Mesoblastic Nephroma | 2 | ORPHANET |
Hgene | NTRK3 | C0014175 | Endometriosis | 1 | CTD_human |
Hgene | NTRK3 | C0017638 | Glioma | 1 | CTD_human |
Hgene | NTRK3 | C0019569 | Hirschsprung Disease | 1 | GENOMICS_ENGLAND |
Hgene | NTRK3 | C0023467 | Leukemia, Myelocytic, Acute | 1 | CTD_human |
Hgene | NTRK3 | C0026998 | Acute Myeloid Leukemia, M1 | 1 | CTD_human |
Hgene | NTRK3 | C0038220 | Status Epilepticus | 1 | CTD_human |
Hgene | NTRK3 | C0238463 | Papillary thyroid carcinoma | 1 | ORPHANET |
Hgene | NTRK3 | C0259783 | mixed gliomas | 1 | CTD_human |
Hgene | NTRK3 | C0269102 | Endometrioma | 1 | CTD_human |
Hgene | NTRK3 | C0270823 | Petit mal status | 1 | CTD_human |
Hgene | NTRK3 | C0311335 | Grand Mal Status Epilepticus | 1 | CTD_human |
Hgene | NTRK3 | C0393734 | Complex Partial Status Epilepticus | 1 | CTD_human |
Hgene | NTRK3 | C0525045 | Mood Disorders | 1 | PSYGENET |
Hgene | NTRK3 | C0555198 | Malignant Glioma | 1 | CTD_human |
Hgene | NTRK3 | C0751522 | Status Epilepticus, Subclinical | 1 | CTD_human |
Hgene | NTRK3 | C0751523 | Non-Convulsive Status Epilepticus | 1 | CTD_human |
Hgene | NTRK3 | C0751524 | Simple Partial Status Epilepticus | 1 | CTD_human |
Hgene | NTRK3 | C1879321 | Acute Myeloid Leukemia (AML-M2) | 1 | CTD_human |