![]() |
|||||||
|
Fusion Protein:NUP214-CACNA1B |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: NUP214-CACNA1B | FusionPDB ID: 61038 | FusionGDB2.0 ID: 61038 | Hgene | Tgene | Gene symbol | NUP214 | CACNA1B | Gene ID | 8021 | 774 |
Gene name | nucleoporin 214 | calcium voltage-gated channel subunit alpha1 B | |
Synonyms | CAIN|CAN|IIAE9 | BIII|CACNL1A5|CACNN|Cav2.2|DYT23|NEDNEH | |
Cytomap | 9q34.13 | 9q34.3 | |
Type of gene | protein-coding | protein-coding | |
Description | nuclear pore complex protein Nup214CAN protein, putative oncogenenucleoporin 214kDa | voltage-dependent N-type calcium channel subunit alpha-1BCav2.2 voltage-gated Ca2+ channelbrain calcium channel IIIcalcium channel alpha12.2 subunitcalcium channel, L type, alpha-1 polypeptidecalcium channel, voltage-dependent, L type, alpha 1B subun | |
Modification date | 20200322 | 20200313 | |
UniProtAcc | P35658 Main function of 5'-partner protein: FUNCTION: Part of the nuclear pore complex (PubMed:9049309). Has a critical role in nucleocytoplasmic transport (PubMed:31178128). May serve as a docking site in the receptor-mediated import of substrates across the nuclear pore complex (PubMed:31178128, PubMed:8108440). {ECO:0000269|PubMed:31178128, ECO:0000269|PubMed:9049309, ECO:0000303|PubMed:8108440}.; FUNCTION: (Microbial infection) Required for capsid disassembly of the human adenovirus 5 (HadV-5) leading to release of the viral genome to the nucleus (in vitro). {ECO:0000269|PubMed:25410864}. | Q00975 Main function of 5'-partner protein: FUNCTION: Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death. The isoform alpha-1B gives rise to N-type calcium currents. N-type calcium channels belong to the 'high-voltage activated' (HVA) group and are specifically blocked by omega-conotoxin-GVIA (AC P01522) (AC P01522) (By similarity). They are however insensitive to dihydropyridines (DHP). Calcium channels containing alpha-1B subunit may play a role in directed migration of immature neurons. {ECO:0000250|UniProtKB:Q02294}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000359428, ENST00000411637, ENST00000451030, ENST00000465486, ENST00000483497, | ENST00000371365, ENST00000277550, ENST00000371367, ENST00000545473, ENST00000277549, ENST00000277551, ENST00000371355, ENST00000371357, ENST00000371363, ENST00000371372, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 11 X 15 X 5=825 | 7 X 8 X 4=224 |
# samples | 14 | 7 | |
** MAII score | log2(14/825*10)=-2.55896729218821 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/224*10)=-1.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: NUP214 [Title/Abstract] AND CACNA1B [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: NUP214 [Title/Abstract] AND CACNA1B [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NUP214(134039531)-CACNA1B(141006850), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | NUP214-CACNA1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NUP214-CACNA1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NUP214-CACNA1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NUP214-CACNA1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | CACNA1B | GO:0050804 | modulation of chemical synaptic transmission | 23376566 |
Tgene | CACNA1B | GO:1904645 | response to amyloid-beta | 23376566 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:134039531/chr9:141006850) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000277551 | CACNA1B | chr9 | 141006850 | + | 4622 | 3037 | 21 | 4322 | 1433 |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000371372 | CACNA1B | chr9 | 141006850 | + | 7254 | 3037 | 21 | 4628 | 1535 |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000277549 | CACNA1B | chr9 | 141006850 | + | 7254 | 3037 | 21 | 4628 | 1535 |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000371363 | CACNA1B | chr9 | 141006850 | + | 7254 | 3037 | 21 | 4628 | 1535 |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000371355 | CACNA1B | chr9 | 141006850 | + | 7254 | 3037 | 21 | 4628 | 1535 |
ENST00000359428 | NUP214 | chr9 | 134039531 | + | ENST00000371357 | CACNA1B | chr9 | 141006850 | + | 7254 | 3037 | 21 | 4628 | 1535 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000277551 | CACNA1B | chr9 | 141006850 | + | 4567 | 2982 | 8 | 4267 | 1419 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000371372 | CACNA1B | chr9 | 141006850 | + | 7199 | 2982 | 8 | 4573 | 1521 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000277549 | CACNA1B | chr9 | 141006850 | + | 7199 | 2982 | 8 | 4573 | 1521 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000371363 | CACNA1B | chr9 | 141006850 | + | 7199 | 2982 | 8 | 4573 | 1521 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000371355 | CACNA1B | chr9 | 141006850 | + | 7199 | 2982 | 8 | 4573 | 1521 |
ENST00000411637 | NUP214 | chr9 | 134039531 | + | ENST00000371357 | CACNA1B | chr9 | 141006850 | + | 7199 | 2982 | 8 | 4573 | 1521 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000277551 | CACNA1B | chr9 | 141006850 | + | 4592 | 3007 | 0 | 4292 | 1430 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000371372 | CACNA1B | chr9 | 141006850 | + | 7224 | 3007 | 0 | 4598 | 1532 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000277549 | CACNA1B | chr9 | 141006850 | + | 7224 | 3007 | 0 | 4598 | 1532 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000371363 | CACNA1B | chr9 | 141006850 | + | 7224 | 3007 | 0 | 4598 | 1532 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000371355 | CACNA1B | chr9 | 141006850 | + | 7224 | 3007 | 0 | 4598 | 1532 |
ENST00000451030 | NUP214 | chr9 | 134039531 | + | ENST00000371357 | CACNA1B | chr9 | 141006850 | + | 7224 | 3007 | 0 | 4598 | 1532 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000359428 | ENST00000277551 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001842046 | 0.9981579 |
ENST00000359428 | ENST00000371372 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001090032 | 0.99890995 |
ENST00000359428 | ENST00000277549 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001090032 | 0.99890995 |
ENST00000359428 | ENST00000371363 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001090032 | 0.99890995 |
ENST00000359428 | ENST00000371355 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001090032 | 0.99890995 |
ENST00000359428 | ENST00000371357 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001090032 | 0.99890995 |
ENST00000411637 | ENST00000277551 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001339139 | 0.9986608 |
ENST00000411637 | ENST00000371372 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001912394 | 0.9980876 |
ENST00000411637 | ENST00000277549 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001912394 | 0.9980876 |
ENST00000411637 | ENST00000371363 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001912394 | 0.9980876 |
ENST00000411637 | ENST00000371355 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001912394 | 0.9980876 |
ENST00000411637 | ENST00000371357 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001912394 | 0.9980876 |
ENST00000451030 | ENST00000277551 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001876267 | 0.9981237 |
ENST00000451030 | ENST00000371372 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001251962 | 0.99874806 |
ENST00000451030 | ENST00000277549 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001251962 | 0.99874806 |
ENST00000451030 | ENST00000371363 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001251962 | 0.99874806 |
ENST00000451030 | ENST00000371355 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001251962 | 0.99874806 |
ENST00000451030 | ENST00000371357 | NUP214 | chr9 | 134039531 | + | CACNA1B | chr9 | 141006850 | + | 0.001251962 | 0.99874806 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NUP214-CACNA1B |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
NUP214 | chr9 | 134039531 | CACNA1B | chr9 | 141006850 | 2982 | 991 | AKRKTPPVRSTAPAGTKQHQCDAELR |
NUP214 | chr9 | 134039531 | CACNA1B | chr9 | 141006850 | 3007 | 1002 | AKRKTPPVRSTAPAGTKQHQCDAELR |
NUP214 | chr9 | 134039531 | CACNA1B | chr9 | 141006850 | 3037 | 1005 | AKRKTPPVRSTAPAGTKQHQCDAELR |
Top |
Potential FusionNeoAntigen Information of NUP214-CACNA1B in HLA I |
![]() |
NUP214-CACNA1B_134039531_141006850.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A11:03 | RSTAPAGTK | 0.9979 | 0.5342 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A11:04 | RSTAPAGTK | 0.9946 | 0.5351 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A30:08 | RSTAPAGTK | 0.9938 | 0.8077 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A03:12 | RSTAPAGTK | 0.9885 | 0.5045 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A11:01 | RSTAPAGTK | 0.9977 | 0.5313 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A11:02 | RSTAPAGTK | 0.9977 | 0.5313 | 8 | 17 |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 | HLA-A30:01 | RSTAPAGTK | 0.994 | 0.897 | 8 | 17 |
Top |
Potential FusionNeoAntigen Information of NUP214-CACNA1B in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NUP214-CACNA1B |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7088 | PVRSTAPAGTKQHQ | NUP214 | CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 3037 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NUP214-CACNA1B |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7088 | PVRSTAPAGTKQHQ | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 7088 | PVRSTAPAGTKQHQ | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 7088 | PVRSTAPAGTKQHQ | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 7088 | PVRSTAPAGTKQHQ | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 7088 | PVRSTAPAGTKQHQ | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 7088 | PVRSTAPAGTKQHQ | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 7088 | PVRSTAPAGTKQHQ | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 7088 | PVRSTAPAGTKQHQ | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 7088 | PVRSTAPAGTKQHQ | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 7088 | PVRSTAPAGTKQHQ | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 7088 | PVRSTAPAGTKQHQ | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of NUP214-CACNA1B |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
NUP214-CACNA1B | chr9 | 134039531 | chr9 | 141006850 | 8 | 17 | RSTAPAGTK | GATCCACTGCTCCAGCTGGGACAAAGC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NUP214-CACNA1B |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | NUP214-CACNA1B | chr9 | 134039531 | ENST00000359428 | chr9 | 141006850 | ENST00000277549 | TCGA-24-1849-01A |
Top |
Potential target of CAR-T therapy development for NUP214-CACNA1B |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NUP214-CACNA1B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NUP214-CACNA1B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | NUP214 | C0025958 | Microcephaly | 1 | GENOMICS_ENGLAND |
Hgene | NUP214 | C0543888 | Epileptic encephalopathy | 1 | GENOMICS_ENGLAND |
Hgene | NUP214 | C1836830 | Developmental regression | 1 | GENOMICS_ENGLAND |
Hgene | NUP214 | C1961099 | Precursor T-Cell Lymphoblastic Leukemia-Lymphoma | 1 | ORPHANET |