Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:OGDH-TRIM24

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: OGDH-TRIM24
	FusionPDB ID: 61404
	FusionGDB2.0 ID: 61404
		Hgene	Tgene
	Gene symbol	OGDH	TRIM24
	Gene ID	4967	8805
	Gene name	oxoglutarate dehydrogenase	tripartite motif containing 24
	Synonyms	AKGDH\|E1k\|OGDC	PTC6\|RNF82\|TF1A\|TIF1\|TIF1A\|TIF1ALPHA\|hTIF1
	Cytomap	7p13	7q33-q34
	Type of gene	protein-coding	protein-coding
	Description	2-oxoglutarate dehydrogenase, mitochondrial2-oxoglutarate dehydrogenase complex component E1OGDC-E1oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)oxoglutarate decarboxylaseoxoglutarate dehydrogenase (succinyl-transferring)testicular tis	transcription intermediary factor 1-alphaE3 ubiquitin-protein ligase TRIM24RING finger protein 82RING-type E3 ubiquitin transferase TIF1-alphaTIF1-alphatranscriptional intermediary factor 1
	Modification date	20200313	20200313
	UniProtAcc	.	O15164 Main function of 5'-partner protein: FUNCTION: Transcriptional coactivator that interacts with numerous nuclear receptors and coactivators and modulates the transcription of target genes. Interacts with chromatin depending on histone H3 modifications, having the highest affinity for histone H3 that is both unmodified at 'Lys-4' (H3K4me0) and acetylated at 'Lys-23' (H3K23ac). Has E3 protein-ubiquitin ligase activity. Promotes ubiquitination and proteasomal degradation of p53/TP53. Plays a role in the regulation of cell proliferation and apoptosis, at least in part via its effects on p53/TP53 levels. Up-regulates ligand-dependent transcription activation by AR, GCR/NR3C1, thyroid hormone receptor (TR) and ESR1. Modulates transcription activation by retinoic acid (RA) receptors, including RARA. Plays a role in regulating retinoic acid-dependent proliferation of hepatocytes (By similarity). {ECO:0000250, ECO:0000269\|PubMed:16322096, ECO:0000269\|PubMed:19556538, ECO:0000269\|PubMed:21164480}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000222673, ENST00000443864, ENST00000444676, ENST00000439616, ENST00000447398, ENST00000449767, ENST00000459672, ENST00000543843,	ENST00000497516, ENST00000343526, ENST00000415680,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 3=105	10 X 9 X 7=630
	# samples	7	11
	** MAII score	log2(7/105*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/630*10)=-2.51784830486262 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: OGDH [Title/Abstract] AND TRIM24 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: OGDH [Title/Abstract] AND TRIM24 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	OGDH(44687358)-TRIM24(138189035), # samples:1
Anticipated loss of major functional domain due to fusion event.	OGDH-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OGDH-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OGDH-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. OGDH-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	OGDH	GO:0006103	2-oxoglutarate metabolic process	24495017\|29211711
Hgene	OGDH	GO:0006104	succinyl-CoA metabolic process	24495017\|29211711
Hgene	OGDH	GO:0106077	histone succinylation	29211711
Tgene	TRIM24	GO:0016567	protein ubiquitination	19556538
Tgene	TRIM24	GO:0071391	cellular response to estrogen stimulus	21164480

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:44687358/chr7:138189035)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across OGDH (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TRIM24 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000443864	OGDH	chr7	44687358	+	ENST00000343526	TRIM24	chr7	138189035	+	8441	610	51	3398	1115
ENST00000443864	OGDH	chr7	44687358	+	ENST00000415680	TRIM24	chr7	138189035	+	3931	610	51	3296	1081
ENST00000444676	OGDH	chr7	44687358	+	ENST00000343526	TRIM24	chr7	138189035	+	8401	570	11	3358	1115
ENST00000444676	OGDH	chr7	44687358	+	ENST00000415680	TRIM24	chr7	138189035	+	3891	570	11	3256	1081
ENST00000222673	OGDH	chr7	44687358	+	ENST00000343526	TRIM24	chr7	138189035	+	8390	559	0	3347	1115
ENST00000222673	OGDH	chr7	44687358	+	ENST00000415680	TRIM24	chr7	138189035	+	3880	559	0	3245	1081

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000443864	ENST00000343526	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	9.23E-05	0.99990773
ENST00000443864	ENST00000415680	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	0.00029274	0.9997073
ENST00000444676	ENST00000343526	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	8.89E-05	0.99991107
ENST00000444676	ENST00000415680	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	0.000292769	0.99970716
ENST00000222673	ENST00000343526	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	8.81E-05	0.9999119
ENST00000222673	ENST00000415680	OGDH	chr7	44687358	+	TRIM24	chr7	138189035	+	0.000291914	0.9997081

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for OGDH-TRIM24

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
OGDH	chr7	44687358	TRIM24	chr7	138189035	559	186	SVPADIISSTDKLVGVIRCPVCSQEC
OGDH	chr7	44687358	TRIM24	chr7	138189035	570	186	SVPADIISSTDKLVGVIRCPVCSQEC
OGDH	chr7	44687358	TRIM24	chr7	138189035	610	186	SVPADIISSTDKLVGVIRCPVCSQEC

Top

Potential FusionNeoAntigen Information of OGDH-TRIM24 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

OGDH-TRIM24_44687358_138189035.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C05:09	STDKLVGV	1	0.789	8	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C05:09	STDKLVGVI	0.9999	0.6894	8	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C08:15	STDKLVGVI	0.9997	0.6892	8	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C15:06	SSTDKLVGV	0.9991	0.6168	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C12:04	SSTDKLVGV	0.9664	0.955	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C06:03	SSTDKLVGV	0.9586	0.9503	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C02:06	SSTDKLVGV	0.4415	0.8242	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C05:01	STDKLVGV	1	0.789	8	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C05:01	STDKLVGVI	0.9999	0.6894	8	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C08:02	STDKLVGVI	0.9997	0.6892	8	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C15:02	SSTDKLVGV	0.9995	0.5478	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C15:05	SSTDKLVGV	0.9994	0.6671	7	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	HLA-C16:02	SSTDKLVGV	0.965	0.9669	7	16

Top

Potential FusionNeoAntigen Information of OGDH-TRIM24 in HLA II

OGDH-TRIM24_44687358_138189035.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0804	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0820	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0831	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0906	VPADIISSTDKLVGV	1	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0906	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-0906	SVPADIISSTDKLVG	0	15
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1104	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1106	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1117	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1135	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1138	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1143	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1144	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1146	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1147	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1150	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1152	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1154	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1156	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1158	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1160	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1177	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1178	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1183	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1188	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1311	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1342	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1405	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1408	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1410	VPADIISSTDKLVGV	1	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1410	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1410	SVPADIISSTDKLVG	0	15
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1411	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1411	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1415	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1423	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1433	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1439	VPADIISSTDKLVGV	1	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1439	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1443	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1445	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1456	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1459	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1470	VPADIISSTDKLVGV	1	16
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1470	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1473	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1480	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1491	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1496	ADIISSTDKLVGVIR	3	18
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1525	PADIISSTDKLVGVI	2	17
OGDH-TRIM24	chr7	44687358	chr7	138189035	559	DRB1-1525	VPADIISSTDKLVGV	1	16

Top

Fusion breakpoint peptide structures of OGDH-TRIM24

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4002	ISSTDKLVGVIRCP	OGDH	TRIM24	chr7	44687358	chr7	138189035	559

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of OGDH-TRIM24

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4002	ISSTDKLVGVIRCP	-7.15543	-7.26883
HLA-B14:02	3BVN	4002	ISSTDKLVGVIRCP	-4.77435	-5.80965
HLA-B52:01	3W39	4002	ISSTDKLVGVIRCP	-6.80875	-6.92215
HLA-B52:01	3W39	4002	ISSTDKLVGVIRCP	-4.20386	-5.23916
HLA-A11:01	4UQ2	4002	ISSTDKLVGVIRCP	-7.5194	-8.5547
HLA-A11:01	4UQ2	4002	ISSTDKLVGVIRCP	-6.9601	-7.0735
HLA-A24:02	5HGA	4002	ISSTDKLVGVIRCP	-7.52403	-7.63743
HLA-A24:02	5HGA	4002	ISSTDKLVGVIRCP	-5.82433	-6.85963
HLA-B27:05	6PYJ	4002	ISSTDKLVGVIRCP	-3.28285	-4.31815
HLA-B44:05	3DX8	4002	ISSTDKLVGVIRCP	-5.91172	-6.94702
HLA-B44:05	3DX8	4002	ISSTDKLVGVIRCP	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of OGDH-TRIM24

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
OGDH-TRIM24	chr7	44687358	chr7	138189035	7	16	SSTDKLVGV	CATCCACAGACAAACTTGTTGGAGTCA
OGDH-TRIM24	chr7	44687358	chr7	138189035	8	16	STDKLVGV	CCACAGACAAACTTGTTGGAGTCA
OGDH-TRIM24	chr7	44687358	chr7	138189035	8	17	STDKLVGVI	CCACAGACAAACTTGTTGGAGTCATTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
OGDH-TRIM24	chr7	44687358	chr7	138189035	0	15	SVPADIISSTDKLVG	CCGTGCCCGCTGACATTATCTCATCCACAGACAAACTTGTTGGAG
OGDH-TRIM24	chr7	44687358	chr7	138189035	1	16	VPADIISSTDKLVGV	TGCCCGCTGACATTATCTCATCCACAGACAAACTTGTTGGAGTCA
OGDH-TRIM24	chr7	44687358	chr7	138189035	2	17	PADIISSTDKLVGVI	CCGCTGACATTATCTCATCCACAGACAAACTTGTTGGAGTCATTC
OGDH-TRIM24	chr7	44687358	chr7	138189035	3	18	ADIISSTDKLVGVIR	CTGACATTATCTCATCCACAGACAAACTTGTTGGAGTCATTCGTT

Top

Information of the samples that have these potential fusion neoantigens of OGDH-TRIM24

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	OGDH-TRIM24	chr7	44687358	ENST00000222673	chr7	138189035	ENST00000343526	ERR315451

Top

Potential target of CAR-T therapy development for OGDH-TRIM24

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to OGDH-TRIM24

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to OGDH-TRIM24

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	TRIM24	C0238463	Papillary thyroid carcinoma	2	ORPHANET
Tgene	TRIM24	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
Tgene	TRIM24	C2239176	Liver carcinoma	1	CTD_human
Tgene	TRIM24	C3658266	Prostatic Cancer, Castration-Resistant	1	CTD_human
Tgene	TRIM24	C3658267	Prostatic Neoplasms, Castration-Resistant	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)