Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PACS2-MTCH1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PACS2-MTCH1
	FusionPDB ID: 62270
	FusionGDB2.0 ID: 62270
		Hgene	Tgene
	Gene symbol	PACS2	MTCH1
	Gene ID	23241	23787
	Gene name	phosphofurin acidic cluster sorting protein 2	mitochondrial carrier 1
	Synonyms	EIEE66\|PACS-2\|PACS1L	CGI-64\|PIG60\|PSAP\|SLC25A49
	Cytomap	14q32.33	6p21.2
	Type of gene	protein-coding	protein-coding
	Description	phosphofurin acidic cluster sorting protein 2PACS1-like protein	mitochondrial carrier homolog 1cell proliferation-inducing protein 60presenilin-associated proteinsolute carrier family 25, member 49
	Modification date	20200313	20200313
	UniProtAcc	.	Q9NZJ7 Main function of 5'-partner protein: FUNCTION: Potential mitochondrial transporter. May play a role in apoptosis. {ECO:0000269\|PubMed:12377771}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000325438, ENST00000430725, ENST00000447393, ENST00000458164, ENST00000547217, ENST00000551743, ENST00000551801,	ENST00000471737, ENST00000538808, ENST00000373616, ENST00000373627,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 12 X 6=936	12 X 13 X 3=468
	# samples	14	13
	** MAII score	log2(14/936*10)=-2.74108170263844 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/468*10)=-1.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PACS2 [Title/Abstract] AND MTCH1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PACS2 [Title/Abstract] AND MTCH1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PACS2(105849850)-MTCH1(36936750), # samples:1
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PACS2	GO:0000045	autophagosome assembly	23455425
Hgene	PACS2	GO:0034497	protein localization to phagophore assembly site	23455425

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:105849850/chr6:36936750)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PACS2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MTCH1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000430725	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	2876	2042	304	2118	604
ENST00000430725	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	2876	2042	304	2118	604
ENST00000325438	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	3106	2272	177	2348	723
ENST00000325438	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	3106	2272	177	2348	723
ENST00000458164	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	2789	1955	175	2031	618
ENST00000458164	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	2789	1955	175	2031	618
ENST00000447393	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	2789	1955	175	2031	618
ENST00000447393	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	2789	1955	175	2031	618
ENST00000547217	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	2544	1710	32	1786	584
ENST00000547217	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	2544	1710	32	1786	584
ENST00000551743	PACS2	chr14	105849850	+	ENST00000373627	MTCH1	chr6	36936750	-	1229	395	654	160	164
ENST00000551743	PACS2	chr14	105849850	+	ENST00000373616	MTCH1	chr6	36936750	-	1229	395	654	160	164

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000430725	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.015128662	0.9848713
ENST00000430725	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.015128662	0.9848713
ENST00000325438	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.019910071	0.9800899
ENST00000325438	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.019910071	0.9800899
ENST00000458164	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.022339143	0.9776609
ENST00000458164	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.022339143	0.9776609
ENST00000447393	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.022339143	0.9776609
ENST00000447393	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.022339143	0.9776609
ENST00000547217	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.018887749	0.98111224
ENST00000547217	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.018887749	0.98111224
ENST00000551743	ENST00000373627	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.6151982	0.3848018
ENST00000551743	ENST00000373616	PACS2	chr14	105849850	+	MTCH1	chr6	36936750	-	0.6151982	0.3848018

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PACS2-MTCH1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PACS2	chr14	105849850	MTCH1	chr6	36936750	1710	559	DWLGYMRFLVIPLGPALPRLQPAFPP
PACS2	chr14	105849850	MTCH1	chr6	36936750	1955	593	DWLGYMRFLVIPLGPALPRLQPAFPP
PACS2	chr14	105849850	MTCH1	chr6	36936750	2042	579	DWLGYMRFLVIPLGPALPRLQPAFPP
PACS2	chr14	105849850	MTCH1	chr6	36936750	2272	698	DWLGYMRFLVIPLGPALPRLQPAFPP

Top

Potential FusionNeoAntigen Information of PACS2-MTCH1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PACS2-MTCH1_105849850_36936750.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:03	LVIPLGPAL	0.9507	0.8681	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:21	LVIPLGPAL	0.911	0.5118	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:04	LVIPLGPAL	0.8635	0.5666	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:02	LVIPLGPAL	0.8026	0.9625	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:04	LVIPLGPAL	0.8026	0.9625	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:04	FLVIPLGPAL	0.9518	0.6375	7	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:03	IPLGPALPRL	0.9335	0.8656	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:04	IPLGPALPRL	0.8584	0.9301	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:02	IPLGPALPRL	0.8584	0.9301	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:17	IPLGPALPRL	0.5697	0.5818	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:04	IPLGPALPRL	0.5498	0.7489	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A68:08	LVIPLGPALPR	0.9862	0.7112	8	19
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:17	VIPLGPAL	0.9825	0.9341	9	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:30	VIPLGPAL	0.9712	0.9713	9	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:08	LVIPLGPAL	0.9988	0.8995	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:07	LVIPLGPAL	0.9986	0.971	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:19	LVIPLGPAL	0.9978	0.9909	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C12:12	LVIPLGPAL	0.9947	0.9112	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C15:06	LVIPLGPAL	0.9942	0.8788	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C04:06	LVIPLGPAL	0.9922	0.9083	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C08:13	LVIPLGPAL	0.9846	0.959	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C08:04	LVIPLGPAL	0.9846	0.959	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B73:01	MRFLVIPLG	0.9711	0.7083	5	14
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B15:21	LVIPLGPAL	0.967	0.9318	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B15:04	LVIPLGPAL	0.9546	0.8874	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C08:03	LVIPLGPAL	0.9487	0.9843	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:14	LVIPLGPAL	0.9144	0.9744	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C02:06	LVIPLGPAL	0.906	0.9729	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:12	LVIPLGPAL	0.8026	0.9625	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B39:10	LVIPLGPAL	0.6886	0.8648	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:17	LVIPLGPAL	0.6848	0.9153	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:30	LVIPLGPAL	0.5143	0.9678	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B73:01	MRFLVIPLGP	0.9942	0.7261	5	15
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:12	IPLGPALPRL	0.8584	0.9301	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B42:01	IPLGPALPRL	0.6196	0.8295	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B39:10	IPLGPALPRL	0.6191	0.9689	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B73:01	MRFLVIPLGPA	0.9995	0.7262	5	16
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:30	VIPLGPALPRL	0.9505	0.981	9	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:17	VIPLGPALPRL	0.93	0.9734	9	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:07	VIPLGPALPRL	0.7915	0.6022	9	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:02	VIPLGPAL	0.9768	0.9328	9	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:03	VIPLGPAL	0.8523	0.8108	9	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:04	LVIPLGPAL	0.9989	0.9919	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:03	LVIPLGPAL	0.9989	0.9919	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:17	LVIPLGPAL	0.9979	0.9738	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:67	LVIPLGPAL	0.9978	0.9863	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:05	LVIPLGPAL	0.9974	0.9287	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:02	LVIPLGPAL	0.9969	0.9728	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C12:03	LVIPLGPAL	0.9935	0.9805	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C12:02	LVIPLGPAL	0.993	0.9749	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:06	LVIPLGPAL	0.9895	0.9926	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B15:08	LVIPLGPAL	0.9738	0.8561	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:11	LVIPLGPAL	0.9685	0.9254	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B15:73	LVIPLGPAL	0.968	0.9375	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C08:01	LVIPLGPAL	0.9487	0.9843	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:13	LVIPLGPAL	0.942	0.8707	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B15:30	LVIPLGPAL	0.9223	0.93	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B07:13	LVIPLGPAL	0.9125	0.7349	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A02:06	LVIPLGPAL	0.911	0.5118	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-A69:01	LVIPLGPAL	0.9078	0.5924	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C02:02	LVIPLGPAL	0.8756	0.9771	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C02:10	LVIPLGPAL	0.8756	0.9771	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:09	LVIPLGPAL	0.8026	0.9625	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B67:01	LVIPLGPAL	0.7421	0.6689	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:02	LVIPLGPAL	0.6834	0.9151	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C17:01	LVIPLGPAL	0.6342	0.9046	8	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:03	FLVIPLGPAL	0.9875	0.9873	7	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:04	FLVIPLGPAL	0.9875	0.9873	7	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C03:05	FLVIPLGPAL	0.9642	0.9134	7	17
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:13	IPLGPALPRL	0.9259	0.8681	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B35:09	IPLGPALPRL	0.8584	0.9301	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-B67:01	IPLGPALPRL	0.6297	0.9406	10	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:03	VIPLGPALPRL	0.9494	0.9388	9	20
PACS2-MTCH1	chr14	105849850	chr6	36936750	2272	HLA-C01:02	VIPLGPALPRL	0.9354	0.9714	9	20

Top

Potential FusionNeoAntigen Information of PACS2-MTCH1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PACS2-MTCH1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7840	RFLVIPLGPALPRL	PACS2	MTCH1	chr14	105849850	chr6	36936750	2272

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PACS2-MTCH1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7840	RFLVIPLGPALPRL	-7.15543	-7.26883
HLA-B14:02	3BVN	7840	RFLVIPLGPALPRL	-4.77435	-5.80965
HLA-B52:01	3W39	7840	RFLVIPLGPALPRL	-6.80875	-6.92215
HLA-B52:01	3W39	7840	RFLVIPLGPALPRL	-4.20386	-5.23916
HLA-A11:01	4UQ2	7840	RFLVIPLGPALPRL	-7.5194	-8.5547
HLA-A11:01	4UQ2	7840	RFLVIPLGPALPRL	-6.9601	-7.0735
HLA-A24:02	5HGA	7840	RFLVIPLGPALPRL	-7.52403	-7.63743
HLA-A24:02	5HGA	7840	RFLVIPLGPALPRL	-5.82433	-6.85963
HLA-B27:05	6PYJ	7840	RFLVIPLGPALPRL	-3.28285	-4.31815
HLA-B44:05	3DX8	7840	RFLVIPLGPALPRL	-5.91172	-6.94702
HLA-B44:05	3DX8	7840	RFLVIPLGPALPRL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of PACS2-MTCH1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PACS2-MTCH1	chr14	105849850	chr6	36936750	10	20	IPLGPALPRL	TCCCACTGGGGCCAGCTCTTCCGAGGCTCC
PACS2-MTCH1	chr14	105849850	chr6	36936750	5	14	MRFLVIPLG	TGCGCTTCCTGGTCATCCCACTGGGGC
PACS2-MTCH1	chr14	105849850	chr6	36936750	5	15	MRFLVIPLGP	TGCGCTTCCTGGTCATCCCACTGGGGCCAG
PACS2-MTCH1	chr14	105849850	chr6	36936750	5	16	MRFLVIPLGPA	TGCGCTTCCTGGTCATCCCACTGGGGCCAGCTC
PACS2-MTCH1	chr14	105849850	chr6	36936750	7	17	FLVIPLGPAL	TCCTGGTCATCCCACTGGGGCCAGCTCTTC
PACS2-MTCH1	chr14	105849850	chr6	36936750	8	17	LVIPLGPAL	TGGTCATCCCACTGGGGCCAGCTCTTC
PACS2-MTCH1	chr14	105849850	chr6	36936750	8	19	LVIPLGPALPR	TGGTCATCCCACTGGGGCCAGCTCTTCCGAGGC
PACS2-MTCH1	chr14	105849850	chr6	36936750	9	17	VIPLGPAL	TCATCCCACTGGGGCCAGCTCTTC
PACS2-MTCH1	chr14	105849850	chr6	36936750	9	20	VIPLGPALPRL	TCATCCCACTGGGGCCAGCTCTTCCGAGGCTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PACS2-MTCH1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	PACS2-MTCH1	chr14	105849850	ENST00000325438	chr6	36936750	ENST00000373616	TCGA-CD-A4MJ

Top

Potential target of CAR-T therapy development for PACS2-MTCH1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PACS2-MTCH1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PACS2-MTCH1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)