|
|||||||
|
Fusion Protein:PALM2-LPAR1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: PALM2-LPAR1 | FusionPDB ID: 62494 | FusionGDB2.0 ID: 62494 | Hgene | Tgene | Gene symbol | PALM2 | LPAR1 | Gene ID | 445815 | 1902 |
| Gene name | PALM2 and AKAP2 fusion | lysophosphatidic acid receptor 1 | |
| Synonyms | AKAP-2|AKAP-KL|AKAP2|AKAPKL|MISP2|PALM2|PALM2-AKAP2|PRKA2 | EDG2|GPR26|Gpcr26|LPA1|Mrec1.3|VZG1|edg-2|rec.1.3|vzg-1 | |
| Cytomap | 9q31.3 | 9q31.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | A-kinase anchor protein 2PALM2-AKAP2 proteinparalemmin-2A kinase (PRKA) anchor protein 2A-kinase anchoring protein 2PALM2-AKAP2 fusionPALM2-AKAP2 readthroughparalemmin 2protein kinase A anchoring protein 2protein kinase A2 | lysophosphatidic acid receptor 1LPA receptor 1LPA-1endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2lysophosphatidic acid receptor Edg-2ventricular zone gene 1 | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | . | Q92633 Main function of 5'-partner protein: FUNCTION: Receptor for lysophosphatidic acid (LPA) (PubMed:9070858, PubMed:19306925, PubMed:25025571, PubMed:26091040). Plays a role in the reorganization of the actin cytoskeleton, cell migration, differentiation and proliferation, and thereby contributes to the responses to tissue damage and infectious agents. Activates downstream signaling cascades via the G(i)/G(o), G(12)/G(13), and G(q) families of heteromeric G proteins. Signaling inhibits adenylyl cyclase activity and decreases cellular cAMP levels (PubMed:26091040). Signaling triggers an increase of cytoplasmic Ca(2+) levels (PubMed:19656035, PubMed:19733258, PubMed:26091040). Activates RALA; this leads to the activation of phospholipase C (PLC) and the formation of inositol 1,4,5-trisphosphate (PubMed:19306925). Signaling mediates activation of down-stream MAP kinases (By similarity). Contributes to the regulation of cell shape. Promotes Rho-dependent reorganization of the actin cytoskeleton in neuronal cells and neurite retraction (PubMed:26091040). Promotes the activation of Rho and the formation of actin stress fibers (PubMed:26091040). Promotes formation of lamellipodia at the leading edge of migrating cells via activation of RAC1 (By similarity). Through its function as lysophosphatidic acid receptor, plays a role in chemotaxis and cell migration, including responses to injury and wounding (PubMed:18066075, PubMed:19656035, PubMed:19733258). Plays a role in triggering inflammation in response to bacterial lipopolysaccharide (LPS) via its interaction with CD14. Promotes cell proliferation in response to lysophosphatidic acid. Required for normal skeleton development. May play a role in osteoblast differentiation. Required for normal brain development. Required for normal proliferation, survival and maturation of newly formed neurons in the adult dentate gyrus. Plays a role in pain perception and in the initiation of neuropathic pain (By similarity). {ECO:0000250|UniProtKB:P61793, ECO:0000269|PubMed:18066075, ECO:0000269|PubMed:19306925, ECO:0000269|PubMed:19656035, ECO:0000269|PubMed:19733258, ECO:0000269|PubMed:25025571, ECO:0000269|PubMed:26091040, ECO:0000269|PubMed:9070858, ECO:0000305|PubMed:11093753, ECO:0000305|PubMed:9069262}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000314527, ENST00000374531, ENST00000448454, ENST00000483909, | ENST00000358883, ENST00000374430, ENST00000374431, ENST00000538760, ENST00000541779, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 4 X 4=64 | 10 X 6 X 6=360 |
| # samples | 5 | 11 | |
| ** MAII score | log2(5/64*10)=-0.356143810225275 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/360*10)=-1.71049338280502 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: PALM2 [Title/Abstract] AND LPAR1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: PALM2 [Title/Abstract] AND LPAR1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PALM2(112542813)-LPAR1(113638002), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | PALM2-LPAR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PALM2-LPAR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PALM2-LPAR1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. PALM2-LPAR1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | LPAR1 | GO:0007202 | activation of phospholipase C activity | 19306925 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:112542813/chr9:113638002) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across PALM2 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across LPAR1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000374531 | PALM2 | chr9 | 112542813 | + | ENST00000541779 | LPAR1 | chr9 | 113638002 | - | 2584 | 125 | 2257 | 1922 | 111 |
| ENST00000374531 | PALM2 | chr9 | 112542813 | + | ENST00000538760 | LPAR1 | chr9 | 113638002 | - | 672 | 125 | 154 | 426 | 90 |
| ENST00000448454 | PALM2 | chr9 | 112542813 | + | ENST00000541779 | LPAR1 | chr9 | 113638002 | - | 2510 | 51 | 2183 | 1848 | 111 |
| ENST00000448454 | PALM2 | chr9 | 112542813 | + | ENST00000538760 | LPAR1 | chr9 | 113638002 | - | 598 | 51 | 80 | 352 | 90 |
| ENST00000483909 | PALM2 | chr9 | 112542813 | + | ENST00000541779 | LPAR1 | chr9 | 113638002 | - | 2590 | 131 | 67 | 432 | 121 |
| ENST00000483909 | PALM2 | chr9 | 112542813 | + | ENST00000538760 | LPAR1 | chr9 | 113638002 | - | 678 | 131 | 67 | 432 | 121 |
| ENST00000314527 | PALM2 | chr9 | 112542813 | + | ENST00000541779 | LPAR1 | chr9 | 113638002 | - | 2554 | 95 | 31 | 396 | 121 |
| ENST00000314527 | PALM2 | chr9 | 112542813 | + | ENST00000538760 | LPAR1 | chr9 | 113638002 | - | 642 | 95 | 31 | 396 | 121 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000374531 | ENST00000541779 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.689384 | 0.31061605 |
| ENST00000374531 | ENST00000538760 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.18232125 | 0.81767875 |
| ENST00000448454 | ENST00000541779 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.7970169 | 0.20298307 |
| ENST00000448454 | ENST00000538760 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.21420248 | 0.7857975 |
| ENST00000483909 | ENST00000541779 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.86210346 | 0.13789655 |
| ENST00000483909 | ENST00000538760 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.5555594 | 0.44444057 |
| ENST00000314527 | ENST00000541779 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.76421934 | 0.23578061 |
| ENST00000314527 | ENST00000538760 | PALM2 | chr9 | 112542813 | + | LPAR1 | chr9 | 113638002 | - | 0.5060285 | 0.4939715 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PALM2-LPAR1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| PALM2 | chr9 | 112542813 | LPAR1 | chr9 | 113638002 | 131 | 22 | GGIAQGKAASHSRAFIICWTPGLVLL |
| PALM2 | chr9 | 112542813 | LPAR1 | chr9 | 113638002 | 95 | 22 | GGIAQGKAASHSRAFIICWTPGLVLL |
Top |
Potential FusionNeoAntigen Information of PALM2-LPAR1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| PALM2-LPAR1_112542813_113638002.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:01 | HSRAFIICW | 0.9995 | 0.9573 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:02 | HSRAFIICW | 0.9987 | 0.8937 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:01 | HSRAFIICW | 0.9981 | 0.882 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:16 | HSRAFIICW | 0.9939 | 0.6644 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:17 | HSRAFIICW | 0.9935 | 0.8707 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:01 | KAASHSRAF | 0.9933 | 0.9325 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:25 | KAASHSRAF | 0.993 | 0.955 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:17 | KAASHSRAF | 0.9921 | 0.9448 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B39:06 | SHSRAFIIC | 0.9896 | 0.5575 | 9 | 18 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:03 | HSRAFIICW | 0.9867 | 0.9826 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:03 | KAASHSRAF | 0.9817 | 0.8226 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:16 | KAASHSRAF | 0.9805 | 0.8675 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:02 | KAASHSRAF | 0.9794 | 0.9579 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:03 | KAASHSRAF | 0.9597 | 0.9892 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:01 | KAASHSRAF | 0.9501 | 0.9553 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-A32:13 | HSRAFIICW | 0.8846 | 0.955 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-A32:13 | KAASHSRAF | 0.6748 | 0.9472 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:03 | GKAASHSRAF | 0.9675 | 0.8278 | 5 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:01 | ASHSRAFIICW | 0.9999 | 0.9822 | 8 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:12 | AASHSRAF | 0.9975 | 0.9407 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:06 | ASHSRAFII | 0.999 | 0.9203 | 8 | 17 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:07 | KAASHSRAF | 0.9917 | 0.7976 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B39:05 | SHSRAFIIC | 0.9529 | 0.6486 | 9 | 18 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:04 | KAASHSRAF | 0.9501 | 0.9427 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:04 | KAASHSRAF | 0.9282 | 0.9573 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:08 | KAASHSRAF | 0.9224 | 0.9128 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:19 | KAASHSRAF | 0.9018 | 0.8331 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:05 | KAASHSRAF | 0.8937 | 0.8904 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:05 | KAASHSRAF | 0.8698 | 0.9765 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:95 | KAASHSRAF | 0.8641 | 0.7819 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:27 | KAASHSRAF | 0.8536 | 0.9685 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:19 | KAASHSRAF | 0.8486 | 0.9884 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:16 | KAASHSRAF | 0.8305 | 0.9602 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:07 | KAASHSRAF | 0.8114 | 0.9823 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:06 | KAASHSRAF | 0.7412 | 0.9408 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C02:06 | KAASHSRAF | 0.7348 | 0.9838 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:14 | KAASHSRAF | 0.726 | 0.9876 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:12 | KAASHSRAF | 0.7007 | 0.9337 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C04:06 | KAASHSRAF | 0.4191 | 0.7981 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:04 | KAASHSRAF | 0.3769 | 0.9949 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C06:03 | KAASHSRAF | 0.3583 | 0.994 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C08:04 | KAASHSRAF | 0.1312 | 0.9809 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C08:13 | KAASHSRAF | 0.1312 | 0.9809 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C01:30 | KAASHSRAF | 0.1187 | 0.9467 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C08:03 | KAASHSRAF | 0.0438 | 0.9934 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B73:01 | SRAFIICWTP | 0.9472 | 0.7804 | 11 | 21 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:02 | AASHSRAF | 0.9997 | 0.9689 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:04 | AASHSRAF | 0.9983 | 0.9802 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:03 | AASHSRAF | 0.9954 | 0.9867 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:01 | AASHSRAF | 0.9937 | 0.9824 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:02 | AASHSRAF | 0.9767 | 0.9952 | 7 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:10 | HSRAFIICW | 0.9995 | 0.9573 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:02 | ASHSRAFII | 0.9991 | 0.8636 | 8 | 17 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:05 | ASHSRAFII | 0.999 | 0.923 | 8 | 17 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:06 | HSRAFIICW | 0.9979 | 0.735 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:04 | HSRAFIICW | 0.9978 | 0.7805 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:34 | KAASHSRAF | 0.9933 | 0.9325 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:33 | KAASHSRAF | 0.9933 | 0.9325 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:39 | KAASHSRAF | 0.9933 | 0.8786 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:125 | KAASHSRAF | 0.9933 | 0.9325 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:135 | KAASHSRAF | 0.9933 | 0.9372 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:27 | KAASHSRAF | 0.9931 | 0.9351 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:11 | KAASHSRAF | 0.9917 | 0.9144 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:08 | KAASHSRAF | 0.9911 | 0.9107 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:35 | KAASHSRAF | 0.9904 | 0.9313 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:24 | KAASHSRAF | 0.9891 | 0.9569 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B58:06 | KAASHSRAF | 0.9886 | 0.9272 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B35:43 | KAASHSRAF | 0.988 | 0.9131 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-A32:01 | HSRAFIICW | 0.9853 | 0.9549 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:53 | KAASHSRAF | 0.9847 | 0.9172 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:04 | KAASHSRAF | 0.9837 | 0.8412 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B35:11 | KAASHSRAF | 0.9835 | 0.9261 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:50 | KAASHSRAF | 0.9808 | 0.9171 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-A32:01 | KAASHSRAF | 0.9689 | 0.9612 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:02 | HSRAFIICW | 0.9665 | 0.9337 | 10 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:22 | KAASHSRAF | 0.964 | 0.753 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:54 | KAASHSRAF | 0.9576 | 0.9033 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:09 | KAASHSRAF | 0.9501 | 0.9427 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:68 | KAASHSRAF | 0.9439 | 0.7474 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:12 | KAASHSRAF | 0.9436 | 0.8793 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:02 | ASHSRAFII | 0.9401 | 0.9907 | 8 | 17 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:02 | KAASHSRAF | 0.9329 | 0.9725 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B07:13 | KAASHSRAF | 0.9176 | 0.8213 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:20 | KAASHSRAF | 0.8968 | 0.9396 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:67 | KAASHSRAF | 0.8962 | 0.9838 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:01 | KAASHSRAF | 0.8871 | 0.769 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:04 | KAASHSRAF | 0.8869 | 0.9908 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:03 | KAASHSRAF | 0.8869 | 0.9908 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C07:17 | KAASHSRAF | 0.8837 | 0.9696 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B35:28 | KAASHSRAF | 0.8794 | 0.942 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:02 | KAASHSRAF | 0.8271 | 0.9302 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B48:02 | KAASHSRAF | 0.7683 | 0.9306 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:04 | KAASHSRAF | 0.7611 | 0.9704 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:17 | KAASHSRAF | 0.7565 | 0.9714 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:05 | KAASHSRAF | 0.7296 | 0.9066 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:01 | KAASHSRAF | 0.6943 | 0.9795 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:03 | KAASHSRAF | 0.6906 | 0.9817 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C02:10 | KAASHSRAF | 0.6775 | 0.9867 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C02:02 | KAASHSRAF | 0.6775 | 0.9867 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C06:02 | KAASHSRAF | 0.6683 | 0.9937 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C06:17 | KAASHSRAF | 0.6683 | 0.9937 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C06:08 | KAASHSRAF | 0.6452 | 0.9937 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C06:06 | KAASHSRAF | 0.6257 | 0.9929 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C12:02 | KAASHSRAF | 0.616 | 0.9689 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:05 | KAASHSRAF | 0.6074 | 0.8874 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C15:02 | KAASHSRAF | 0.5845 | 0.8804 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C16:02 | KAASHSRAF | 0.4791 | 0.9933 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C03:06 | KAASHSRAF | 0.2837 | 0.9924 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C01:02 | KAASHSRAF | 0.0645 | 0.9365 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-C08:01 | KAASHSRAF | 0.0438 | 0.9934 | 6 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:68 | GKAASHSRAF | 0.9633 | 0.7586 | 5 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B15:54 | GKAASHSRAF | 0.9433 | 0.9 | 5 | 15 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:10 | ASHSRAFIICW | 0.9999 | 0.9822 | 8 | 19 |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 | HLA-B57:04 | ASHSRAFIICW | 0.9998 | 0.8634 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of PALM2-LPAR1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of PALM2-LPAR1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 4093 | KAASHSRAFIICWT | PALM2 | LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 95 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PALM2-LPAR1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 4093 | KAASHSRAFIICWT | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 4093 | KAASHSRAFIICWT | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 4093 | KAASHSRAFIICWT | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 4093 | KAASHSRAFIICWT | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 4093 | KAASHSRAFIICWT | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 4093 | KAASHSRAFIICWT | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 4093 | KAASHSRAFIICWT | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 4093 | KAASHSRAFIICWT | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 4093 | KAASHSRAFIICWT | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 4093 | KAASHSRAFIICWT | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 4093 | KAASHSRAFIICWT | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of PALM2-LPAR1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 10 | 19 | HSRAFIICW | GCCATAGCAGGGCCTTTATCATCTGCT |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 11 | 21 | SRAFIICWTP | ATAGCAGGGCCTTTATCATCTGCTGGACTC |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 5 | 15 | GKAASHSRAF | AAGGAAAGGCTGCAAGCCATAGCAGGGCCT |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 6 | 15 | KAASHSRAF | GAAAGGCTGCAAGCCATAGCAGGGCCT |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 7 | 15 | AASHSRAF | AGGCTGCAAGCCATAGCAGGGCCT |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 8 | 17 | ASHSRAFII | CTGCAAGCCATAGCAGGGCCTTTATCA |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 8 | 19 | ASHSRAFIICW | CTGCAAGCCATAGCAGGGCCTTTATCATCTGCT |
| PALM2-LPAR1 | chr9 | 112542813 | chr9 | 113638002 | 9 | 18 | SHSRAFIIC | CAAGCCATAGCAGGGCCTTTATCATCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of PALM2-LPAR1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| GBM | PALM2-LPAR1 | chr9 | 112542813 | ENST00000314527 | chr9 | 113638002 | ENST00000538760 | TCGA-06-5415-01A |
Top |
Potential target of CAR-T therapy development for PALM2-LPAR1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | LPAR1 | chr9:112542813 | chr9:113638002 | ENST00000358883 | 2 | 4 | 295_315 | 0 | 365.0 | Transmembrane | Note=Helical%3B Name%3D7 | |
| Tgene | LPAR1 | chr9:112542813 | chr9:113638002 | ENST00000374430 | 3 | 5 | 295_315 | 0 | 365.0 | Transmembrane | Note=Helical%3B Name%3D7 | |
| Tgene | LPAR1 | chr9:112542813 | chr9:113638002 | ENST00000374431 | 3 | 5 | 295_315 | 0 | 365.0 | Transmembrane | Note=Helical%3B Name%3D7 |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to PALM2-LPAR1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PALM2-LPAR1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies