Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PANK4-RGS6

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PANK4-RGS6
	FusionPDB ID: 62561
	FusionGDB2.0 ID: 62561
		Hgene	Tgene
	Gene symbol	PANK4	RGS6
	Gene ID	55229	9628
	Gene name	pantothenate kinase 4 (inactive)	regulator of G protein signaling 6
	Synonyms	-	GAP\|HA117\|S914
	Cytomap	1p36.32	14q24.2
	Type of gene	protein-coding	protein-coding
	Description	4'-phosphopantetheine phosphataseinactive pantothenic acid kinase 4pantothenic acid kinase 4	regulator of G-protein signaling 6regulator of G-protein signalling 6
	Modification date	20200315	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000378466, ENST00000435556, ENST00000491212,	ENST00000434263, ENST00000553690, ENST00000554782, ENST00000343854, ENST00000355512, ENST00000402788, ENST00000404301, ENST00000406236, ENST00000407322, ENST00000553525, ENST00000553530, ENST00000555571, ENST00000556437,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 8 X 6=240	11 X 10 X 6=660
	# samples	7	13
	** MAII score	log2(7/240*10)=-1.77760757866355 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/660*10)=-2.34395440121736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PANK4 [Title/Abstract] AND RGS6 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PANK4 [Title/Abstract] AND RGS6 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PANK4(2442777)-RGS6(72818803), # samples:2
Anticipated loss of major functional domain due to fusion event.	PANK4-RGS6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PANK4-RGS6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PANK4-RGS6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PANK4-RGS6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	RGS6	GO:0043547	positive regulation of GTPase activity	10521509

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:2442777/chr14:72818803)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PANK4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RGS6 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000378466	PANK4	chr1	2442777	-	ENST00000553525	RGS6	chr14	72818803	+	3244	1846	13	3234	1073
ENST00000378466	PANK4	chr1	2442777	-	ENST00000555571	RGS6	chr14	72818803	+	3181	1846	13	3180	1056
ENST00000378466	PANK4	chr1	2442777	-	ENST00000553530	RGS6	chr14	72818803	+	4660	1846	13	3180	1055
ENST00000378466	PANK4	chr1	2442777	-	ENST00000556437	RGS6	chr14	72818803	+	3360	1846	13	3234	1073
ENST00000378466	PANK4	chr1	2442777	-	ENST00000355512	RGS6	chr14	72818803	+	3326	1846	13	3144	1043
ENST00000378466	PANK4	chr1	2442777	-	ENST00000406236	RGS6	chr14	72818803	+	3238	1846	13	3189	1058
ENST00000378466	PANK4	chr1	2442777	-	ENST00000404301	RGS6	chr14	72818803	+	3259	1846	13	3204	1063
ENST00000378466	PANK4	chr1	2442777	-	ENST00000407322	RGS6	chr14	72818803	+	3259	1846	13	3195	1060
ENST00000378466	PANK4	chr1	2442777	-	ENST00000402788	RGS6	chr14	72818803	+	3181	1846	13	3180	1056
ENST00000378466	PANK4	chr1	2442777	-	ENST00000343854	RGS6	chr14	72818803	+	3124	1846	13	3123	1037
ENST00000435556	PANK4	chr1	2442777	-	ENST00000553525	RGS6	chr14	72818803	+	3123	1725	9	3113	1034
ENST00000435556	PANK4	chr1	2442777	-	ENST00000555571	RGS6	chr14	72818803	+	3060	1725	9	3059	1016
ENST00000435556	PANK4	chr1	2442777	-	ENST00000553530	RGS6	chr14	72818803	+	4539	1725	9	3059	1016
ENST00000435556	PANK4	chr1	2442777	-	ENST00000556437	RGS6	chr14	72818803	+	3239	1725	9	3113	1034
ENST00000435556	PANK4	chr1	2442777	-	ENST00000355512	RGS6	chr14	72818803	+	3205	1725	9	3023	1004
ENST00000435556	PANK4	chr1	2442777	-	ENST00000406236	RGS6	chr14	72818803	+	3117	1725	9	3068	1019
ENST00000435556	PANK4	chr1	2442777	-	ENST00000404301	RGS6	chr14	72818803	+	3138	1725	9	3083	1024
ENST00000435556	PANK4	chr1	2442777	-	ENST00000407322	RGS6	chr14	72818803	+	3138	1725	9	3074	1021
ENST00000435556	PANK4	chr1	2442777	-	ENST00000402788	RGS6	chr14	72818803	+	3060	1725	9	3059	1016
ENST00000435556	PANK4	chr1	2442777	-	ENST00000343854	RGS6	chr14	72818803	+	3003	1725	9	3002	997

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000378466	ENST00000553525	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002024138	0.9979759
ENST00000378466	ENST00000555571	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001950776	0.99804926
ENST00000378466	ENST00000553530	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.000892187	0.9991078
ENST00000378466	ENST00000556437	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001782697	0.9982173
ENST00000378466	ENST00000355512	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002207698	0.99779236
ENST00000378466	ENST00000406236	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002298077	0.99770194
ENST00000378466	ENST00000404301	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002607186	0.9973928
ENST00000378466	ENST00000407322	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001607223	0.99839276
ENST00000378466	ENST00000402788	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001950776	0.99804926
ENST00000378466	ENST00000343854	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001478995	0.99852103
ENST00000435556	ENST00000553525	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.00153519	0.9984648
ENST00000435556	ENST00000555571	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002481007	0.997519
ENST00000435556	ENST00000553530	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001234212	0.9987658
ENST00000435556	ENST00000556437	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001350767	0.9986493
ENST00000435556	ENST00000355512	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001941425	0.9980585
ENST00000435556	ENST00000406236	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002054522	0.9979455
ENST00000435556	ENST00000404301	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002500155	0.9974999
ENST00000435556	ENST00000407322	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.00188279	0.9981172
ENST00000435556	ENST00000402788	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.002481007	0.997519
ENST00000435556	ENST00000343854	PANK4	chr1	2442777	-	RGS6	chr14	72818803	+	0.001711581	0.99828845

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PANK4-RGS6

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PANK4	chr1	2442777	RGS6	chr14	72818803	1725	572	LVDSYSEWLQRLKIEDIITKMQDDKT
PANK4	chr1	2442777	RGS6	chr14	72818803	1846	611	LVDSYSEWLQRLKIEDIITKMQDDKT

Top

Potential FusionNeoAntigen Information of PANK4-RGS6 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PANK4-RGS6_2442777_72818803.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B44:03	SEWLQRLKI	0.9908	0.9233	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B13:01	SEWLQRLKI	0.9741	0.8426	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B45:01	SEWLQRLKI	0.9706	0.8404	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B41:01	SEWLQRLKI	0.4347	0.8324	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B39:13	SEWLQRLKI	0.1138	0.8522	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B50:01	SEWLQRLKI	0.0923	0.6467	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B52:01	SEWLQRLKI	0.0372	0.9046	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A30:08	RLKIEDIITK	0.992	0.7327	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A74:09	RLKIEDIITK	0.8426	0.5674	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A74:11	RLKIEDIITK	0.8426	0.5674	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A74:03	RLKIEDIITK	0.8426	0.5674	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:05	QRLKIEDIITK	0.9999	0.8156	9	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B40:06	SEWLQRLKI	0.9983	0.5152	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B39:08	SEWLQRLKI	0.2556	0.733	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B51:07	SEWLQRLKI	0.0293	0.765	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:14	QRLKIEDIITK	0.9998	0.7245	9	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:03	QRLKIEDIITK	0.9961	0.8337	9	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:09	QRLKIEDII	0.998	0.7921	9	18
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B44:26	SEWLQRLKI	0.9908	0.9233	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B44:07	SEWLQRLKI	0.9908	0.9233	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B44:13	SEWLQRLKI	0.9908	0.9233	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B40:04	SEWLQRLKI	0.9906	0.6336	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B18:03	SEWLQRLKI	0.7424	0.8937	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B39:02	SEWLQRLKI	0.0984	0.8522	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B50:05	SEWLQRLKI	0.0923	0.6467	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B50:04	SEWLQRLKI	0.0923	0.6467	5	14
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A30:01	RLKIEDIITK	0.9928	0.8521	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-A74:01	RLKIEDIITK	0.8426	0.5674	10	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:10	QRLKIEDIITK	0.9999	0.8097	9	20
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	HLA-B27:08	QRLKIEDIITK	0.9999	0.6825	9	20

Top

Potential FusionNeoAntigen Information of PANK4-RGS6 in HLA II

PANK4-RGS6_2442777_72818803.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0415	RLKIEDIITKMQDDK	10	25
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0436	RLKIEDIITKMQDDK	10	25
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0437	RLKIEDIITKMQDDK	10	25
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0442	RLKIEDIITKMQDDK	10	25
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0453	RLKIEDIITKMQDDK	10	25
PANK4-RGS6	chr1	2442777	chr14	72818803	1846	DRB1-0458	RLKIEDIITKMQDDK	10	25

Top

Fusion breakpoint peptide structures of PANK4-RGS6

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2250	EWLQRLKIEDIITK	PANK4	RGS6	chr1	2442777	chr14	72818803	1846

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PANK4-RGS6

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2250	EWLQRLKIEDIITK	-7.9962	-8.1096
HLA-B14:02	3BVN	2250	EWLQRLKIEDIITK	-5.70842	-6.74372
HLA-B52:01	3W39	2250	EWLQRLKIEDIITK	-6.83737	-6.95077
HLA-B52:01	3W39	2250	EWLQRLKIEDIITK	-4.4836	-5.5189
HLA-A11:01	4UQ2	2250	EWLQRLKIEDIITK	-10.0067	-10.1201
HLA-A11:01	4UQ2	2250	EWLQRLKIEDIITK	-9.03915	-10.0745
HLA-A24:02	5HGA	2250	EWLQRLKIEDIITK	-6.56204	-6.67544
HLA-A24:02	5HGA	2250	EWLQRLKIEDIITK	-5.42271	-6.45801
HLA-B44:05	3DX8	2250	EWLQRLKIEDIITK	-7.85648	-8.89178
HLA-B44:05	3DX8	2250	EWLQRLKIEDIITK	-5.3978	-5.5112
HLA-A02:01	6TDR	2250	EWLQRLKIEDIITK	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PANK4-RGS6

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PANK4-RGS6	chr1	2442777	chr14	72818803	10	20	RLKIEDIITK	AGATTAAAGATTGAAGACATCATTACAAAG
PANK4-RGS6	chr1	2442777	chr14	72818803	5	14	SEWLQRLKI	AGCGAGTGGCTTCAGAGATTAAAGATT
PANK4-RGS6	chr1	2442777	chr14	72818803	9	18	QRLKIEDII	CAGAGATTAAAGATTGAAGACATCATT
PANK4-RGS6	chr1	2442777	chr14	72818803	9	20	QRLKIEDIITK	CAGAGATTAAAGATTGAAGACATCATTACAAAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PANK4-RGS6	chr1	2442777	chr14	72818803	10	25	RLKIEDIITKMQDDK	AGATTAAAGATTGAAGACATCATTACAAAGATGCAAGATGACAAG

Top

Information of the samples that have these potential fusion neoantigens of PANK4-RGS6

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	PANK4-RGS6	chr1	2442777	ENST00000378466	chr14	72818803	ENST00000343854	TCGA-94-8491-01A

Top

Potential target of CAR-T therapy development for PANK4-RGS6

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PANK4-RGS6

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PANK4-RGS6

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)