Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PGPEP1-C10orf76

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PGPEP1-C10orf76
	FusionPDB ID: 64647
	FusionGDB2.0 ID: 64647
		Hgene	Tgene
	Gene symbol	PGPEP1	C10orf76
	Gene ID	54858	79591
	Gene name	pyroglutamyl-peptidase I	armadillo like helical domain containing 3
	Synonyms	PAP-I\|PGI\|PGP\|PGP-I\|PGPI\|Pcp	C10orf76
	Cytomap	19p13.11	10q24.32
	Type of gene	protein-coding	protein-coding
	Description	pyroglutamyl-peptidase 15-oxoprolyl-peptidasepGlu-peptidase Ipyroglutamyl aminopeptidase Ipyrrolidone-carboxylate peptidase	armadillo-like helical domain-containing protein 3UPF0668 protein C10orf76
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269919, ENST00000595066, ENST00000597431, ENST00000604499, ENST00000252813,	ENST00000311122, ENST00000495001, ENST00000370033,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 6=210	8 X 6 X 5=240
	# samples	8	9
	** MAII score	log2(8/210*10)=-1.39231742277876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/240*10)=-1.41503749927884 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PGPEP1 [Title/Abstract] AND C10orf76 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PGPEP1 [Title/Abstract] AND C10orf76 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PGPEP1(18453721)-C10orf76(103773781), # samples:1
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:18453721/chr10:103773781)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PGPEP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across C10orf76 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000269919	PGPEP1	chr19	18453721	+	ENST00000370033	C10orf76	chr10	103773781	-	3512	182	95	1582	495
ENST00000604499	PGPEP1	chr19	18453721	+	ENST00000370033	C10orf76	chr10	103773781	-	3501	171	84	1571	495
ENST00000595066	PGPEP1	chr19	18453721	+	ENST00000370033	C10orf76	chr10	103773781	-	3500	170	83	1570	495
ENST00000597431	PGPEP1	chr19	18453721	+	ENST00000370033	C10orf76	chr10	103773781	-	3460	130	43	1530	495

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000269919	ENST00000370033	PGPEP1	chr19	18453721	+	C10orf76	chr10	103773781	-	0.003398865	0.9966011
ENST00000604499	ENST00000370033	PGPEP1	chr19	18453721	+	C10orf76	chr10	103773781	-	0.003447215	0.9965528
ENST00000595066	ENST00000370033	PGPEP1	chr19	18453721	+	C10orf76	chr10	103773781	-	0.003434324	0.99656576
ENST00000597431	ENST00000370033	PGPEP1	chr19	18453721	+	C10orf76	chr10	103773781	-	0.003116629	0.99688333

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PGPEP1-C10orf76

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PGPEP1	chr19	18453721	C10orf76	chr10	103773781	130	28	FGEHTVNASWIAVQSVNPYIVKLSIV
PGPEP1	chr19	18453721	C10orf76	chr10	103773781	170	28	FGEHTVNASWIAVQSVNPYIVKLSIV
PGPEP1	chr19	18453721	C10orf76	chr10	103773781	171	28	FGEHTVNASWIAVQSVNPYIVKLSIV
PGPEP1	chr19	18453721	C10orf76	chr10	103773781	182	28	FGEHTVNASWIAVQSVNPYIVKLSIV

Top

Potential FusionNeoAntigen Information of PGPEP1-C10orf76 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PGPEP1-C10orf76_18453721_103773781.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B13:02	VQSVNPYI	0.9855	0.7542	12	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B52:01	VQSVNPYI	0.9511	0.9639	12	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:25	IAVQSVNPY	0.9985	0.7696	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:02	IAVQSVNPY	0.9976	0.7936	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:01	IAVQSVNPY	0.9961	0.678	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:01	IAVQSVNPY	0.9948	0.8192	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:08	IAVQSVNPY	0.9937	0.7854	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:17	IAVQSVNPY	0.9837	0.6979	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:16	IAVQSVNPY	0.9515	0.5882	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-A02:21	AVQSVNPYI	0.8687	0.5486	11	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B52:01	ASWIAVQSV	0.8297	0.9876	7	16
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B13:02	VQSVNPYIV	0.735	0.81	12	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B13:02	ASWIAVQSV	0.7241	0.9053	7	16
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B13:02	AVQSVNPYI	0.2936	0.8043	11	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B52:01	VQSVNPYIV	0.0754	0.9745	12	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C15:06	ASWIAVQSV	0.9992	0.8769	7	16
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:21	IAVQSVNPY	0.9977	0.747	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:05	IAVQSVNPY	0.997	0.7609	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:31	IAVQSVNPY	0.9942	0.7739	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C15:04	IAVQSVNPY	0.7812	0.8368	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C03:14	IAVQSVNPY	0.5478	0.9499	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C12:12	IAVQSVNPY	0.4705	0.8568	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C12:04	IAVQSVNPY	0.2513	0.9749	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C15:02	ASWIAVQSV	0.9996	0.874	7	16
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C15:05	ASWIAVQSV	0.9994	0.9219	7	16
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:39	IAVQSVNPY	0.9981	0.6454	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:11	IAVQSVNPY	0.9974	0.7552	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:20	IAVQSVNPY	0.9971	0.8531	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:28	IAVQSVNPY	0.9963	0.8556	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:27	IAVQSVNPY	0.9962	0.7092	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:33	IAVQSVNPY	0.9961	0.678	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:34	IAVQSVNPY	0.9961	0.678	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:125	IAVQSVNPY	0.9961	0.678	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:135	IAVQSVNPY	0.9952	0.6987	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:11	IAVQSVNPY	0.995	0.6356	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:77	IAVQSVNPY	0.9948	0.8192	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:23	IAVQSVNPY	0.9946	0.8385	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:08	IAVQSVNPY	0.9941	0.6315	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:20	IAVQSVNPY	0.994	0.8666	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:43	IAVQSVNPY	0.9919	0.6306	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:50	IAVQSVNPY	0.9917	0.6771	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:35	IAVQSVNPY	0.9857	0.6617	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B15:12	IAVQSVNPY	0.9743	0.7203	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C03:02	IAVQSVNPY	0.9709	0.9467	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:24	IAVQSVNPY	0.9661	0.8441	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:30	IAVQSVNPY	0.9226	0.6489	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B35:17	IAVQSVNPY	0.9226	0.6489	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-A02:06	AVQSVNPYI	0.8687	0.5486	11	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C12:02	IAVQSVNPY	0.7936	0.9211	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C15:09	IAVQSVNPY	0.7812	0.8368	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-A69:01	AVQSVNPYI	0.7025	0.5492	11	20
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C16:04	IAVQSVNPY	0.5874	0.9508	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C12:03	IAVQSVNPY	0.5078	0.9468	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B18:04	IAVQSVNPY	0.4817	0.8233	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C16:01	IAVQSVNPY	0.376	0.9548	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-B18:07	IAVQSVNPY	0.2037	0.7553	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C16:02	IAVQSVNPY	0.1532	0.9779	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C02:02	IAVQSVNPY	0.0599	0.9334	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-C02:10	IAVQSVNPY	0.0599	0.9334	10	19
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	HLA-A30:01	AVQSVNPYIVK	0.9699	0.7569	11	22

Top

Potential FusionNeoAntigen Information of PGPEP1-C10orf76 in HLA II

PGPEP1-C10orf76_18453721_103773781.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1201	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1201	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1203	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1203	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1204	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1205	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1205	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1206	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1206	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1207	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1207	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1208	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1209	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1210	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1210	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1211	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1211	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1212	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1212	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1213	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1214	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1214	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1215	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1217	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1217	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1218	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1219	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1220	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1221	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1222	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1222	NASWIAVQSVNPYIV	6	21
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1223	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB1-1452	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0101	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0103	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0104	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0106	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0107	ASWIAVQSVNPYIVK	7	22
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	182	DRB4-0108	ASWIAVQSVNPYIVK	7	22

Top

Fusion breakpoint peptide structures of PGPEP1-C10orf76

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6090	NASWIAVQSVNPYI	PGPEP1	C10orf76	chr19	18453721	chr10	103773781	182

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PGPEP1-C10orf76

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6090	NASWIAVQSVNPYI	-5.16857	-5.28197
HLA-B14:02	3BVN	6090	NASWIAVQSVNPYI	-4.21097	-5.24627
HLA-B52:01	3W39	6090	NASWIAVQSVNPYI	-4.32839	-4.44179
HLA-B52:01	3W39	6090	NASWIAVQSVNPYI	-4.10962	-5.14492
HLA-A24:02	5HGA	6090	NASWIAVQSVNPYI	-6.03661	-6.15001
HLA-A24:02	5HGA	6090	NASWIAVQSVNPYI	-5.99594	-7.03124
HLA-B44:05	3DX8	6090	NASWIAVQSVNPYI	-6.27779	-6.39119
HLA-B44:05	3DX8	6090	NASWIAVQSVNPYI	-4.76488	-5.80018

Top

Vaccine Design for the FusionNeoAntigens of PGPEP1-C10orf76

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	10	19	IAVQSVNPY	GCAGTTCAGTCTGTGAATCCTTATATT
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	11	20	AVQSVNPYI	GTTCAGTCTGTGAATCCTTATATTGTG
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	11	22	AVQSVNPYIVK	GTTCAGTCTGTGAATCCTTATATTGTGAAGCTG
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	12	20	VQSVNPYI	CAGTCTGTGAATCCTTATATTGTG
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	12	21	VQSVNPYIV	CAGTCTGTGAATCCTTATATTGTGAAG
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	7	16	ASWIAVQSV	AGTTGGATTGCAGTTCAGTCTGTGAAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	6	21	NASWIAVQSVNPYIV	GCCAGTTGGATTGCAGTTCAGTCTGTGAATCCTTATATTGTGAAG
PGPEP1-C10orf76	chr19	18453721	chr10	103773781	7	22	ASWIAVQSVNPYIVK	AGTTGGATTGCAGTTCAGTCTGTGAATCCTTATATTGTGAAGCTG

Top

Information of the samples that have these potential fusion neoantigens of PGPEP1-C10orf76

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
KIRC	PGPEP1-C10orf76	chr19	18453721	ENST00000269919	chr10	103773781	ENST00000370033	TCGA-A3-3323-01A

Top

Potential target of CAR-T therapy development for PGPEP1-C10orf76

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

C10orf76

chr19:18453721

chr10:103773781

ENST00000370033

520_538

690.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PGPEP1-C10orf76

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PGPEP1-C10orf76

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)