Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PIAS1-MAP2K5

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PIAS1-MAP2K5
	FusionPDB ID: 65103
	FusionGDB2.0 ID: 65103
		Hgene	Tgene
	Gene symbol	PIAS1	MAP2K5
	Gene ID	8554	5607
	Gene name	protein inhibitor of activated STAT 1	mitogen-activated protein kinase kinase 5
	Synonyms	DDXBP1\|GBP\|GU/RH-II\|ZMIZ3	HsT17454\|MAPKK5\|MEK5\|PRKMK5
	Cytomap	15q23	15q23
	Type of gene	protein-coding	protein-coding
	Description	E3 SUMO-protein ligase PIAS1AR interacting proteinDEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1DEAD/H box-binding protein 1E3 SUMO-protein transferase PIAS1RNA helicase II-binding proteingu-binding proteinprotein inhibitor of activated STAT pr	dual specificity mitogen-activated protein kinase kinase 5MAP kinase kinase 5MAP kinase kinase MEK5bMAPK/ERK kinase 5MAPKK 5MEK 5
	Modification date	20200313	20200327
	UniProtAcc	.	Q13163 Main function of 5'-partner protein: FUNCTION: Acts as a scaffold for the formation of a ternary MAP3K2/MAP3K3-MAP3K5-MAPK7 signaling complex. Activation of this pathway appears to play a critical role in protecting cells from stress-induced apoptosis, neuronal survival and cardiac development and angiogenesis. {ECO:0000269\|PubMed:7759517, ECO:0000269\|PubMed:9384584}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000249636, ENST00000545237, ENST00000567417,	ENST00000340972, ENST00000354498, ENST00000395476, ENST00000560591, ENST00000178640,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 12 X 7=1092	13 X 18 X 12=2808
	# samples	15	19
	** MAII score	log2(15/1092*10)=-2.86393845042397 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/2808*10)=-3.88547161197361 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PIAS1 [Title/Abstract] AND MAP2K5 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PIAS1 [Title/Abstract] AND MAP2K5 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MAP2K5(67950952)-PIAS1(68434628), # samples:1 PIAS1(68379088)-MAP2K5(67984817), # samples:1
Anticipated loss of major functional domain due to fusion event.	PIAS1-MAP2K5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PIAS1-MAP2K5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PIAS1-MAP2K5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PIAS1-MAP2K5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MAP2K5-PIAS1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. MAP2K5-PIAS1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. MAP2K5-PIAS1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PIAS1	GO:0016925	protein sumoylation	18579533
Hgene	PIAS1	GO:0033235	positive regulation of protein sumoylation	17696781\|21965678

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:67950952/chr15:68434628)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PIAS1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MAP2K5 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000249636

PIAS1

chr15

68379088

ENST00000178640

MAP2K5

chr15

67984817

1490

617

148

1116

322

ENST00000545237

PIAS1

chr15

68379088

ENST00000178640

MAP2K5

chr15

67984817

2089

1216

741

1715

324

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000249636	ENST00000178640	PIAS1	chr15	68379088	-	MAP2K5	chr15	67984817	+	0.011180313	0.98881966
ENST00000545237	ENST00000178640	PIAS1	chr15	68379088	-	MAP2K5	chr15	67984817	+	0.009068359	0.99093163

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PIAS1-MAP2K5

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PIAS1	chr15	68379088	MAP2K5	chr15	67984817	1216	157	FYDLLDELIKPTSLDVKPSNMLVNTR
PIAS1	chr15	68379088	MAP2K5	chr15	67984817	617	155	FYDLLDELIKPTSLDVKPSNMLVNTR

Top

Potential FusionNeoAntigen Information of PIAS1-MAP2K5 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PIAS1-MAP2K5_68379088_67984817.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:01	ELIKPTSL	0.9982	0.7278	6	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:09	ELIKPTSL	0.9966	0.7037	6	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B14:02	DELIKPTSL	0.9994	0.6712	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B14:01	DELIKPTSL	0.9994	0.6712	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B15:37	DELIKPTSL	0.9901	0.6288	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:01	DELIKPTSL	0.9897	0.9166	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:38	SLDVKPSNM	0.8956	0.6129	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:27	SLDVKPSNM	0.8402	0.5413	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:13	SLDVKPSNM	0.8019	0.6259	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:01	DELIKPTSL	0.7335	0.9213	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:13	DELIKPTSL	0.7305	0.9144	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:01	DELIKPTSL	0.7061	0.6673	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:09	DELIKPTSL	0.6808	0.5732	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:22	LLDELIKPTSL	0.9986	0.7548	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:11	LLDELIKPTSL	0.9979	0.6963	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:67	LLDELIKPTSL	0.9976	0.6922	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:30	LLDELIKPTSL	0.9976	0.6922	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:24	LLDELIKPTSL	0.9976	0.6922	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:60	LLDELIKPTSL	0.9975	0.6453	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:16	LLDELIKPTSL	0.9958	0.5724	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:27	SLDVKPSNMLV	0.9933	0.7899	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:27	LLDELIKPTSL	0.9926	0.7369	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:13	SLDVKPSNMLV	0.9922	0.8218	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:60	SLDVKPSNMLV	0.9917	0.8023	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:30	SLDVKPSNMLV	0.9913	0.8228	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:67	SLDVKPSNMLV	0.9913	0.8228	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:24	SLDVKPSNMLV	0.9913	0.8228	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:11	SLDVKPSNMLV	0.9911	0.8311	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:38	SLDVKPSNMLV	0.9904	0.816	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:16	SLDVKPSNMLV	0.9899	0.7752	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:13	LLDELIKPTSL	0.9896	0.722	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:38	LLDELIKPTSL	0.9893	0.706	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:20	LLDELIKPTSL	0.9873	0.698	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:29	LLDELIKPTSL	0.9868	0.6936	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:35	LLDELIKPTSL	0.9824	0.7087	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:19	LLDELIKPTSL	0.9787	0.6356	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:19	SLDVKPSNMLV	0.9746	0.6754	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:29	SLDVKPSNMLV	0.9653	0.8209	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:20	SLDVKPSNMLV	0.9632	0.8256	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:35	SLDVKPSNMLV	0.9524	0.8264	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B14:03	ELIKPTSL	0.9677	0.8395	6	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:10	SLDVKPSNM	0.9999	0.7573	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:15	SLDVKPSNM	0.9999	0.9646	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:09	SLDVKPSNM	0.9999	0.91	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:07	SLDVKPSNM	0.9999	0.7729	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C01:17	SLDVKPSNM	0.9998	0.9502	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C01:30	SLDVKPSNM	0.999	0.9656	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:14	SLDVKPSNM	0.9538	0.8481	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:07	SLDVKPSNM	0.9408	0.6308	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:06	SLDVKPSNM	0.9395	0.8855	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B14:03	DELIKPTSL	0.9376	0.832	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:13	SLDVKPSNM	0.9	0.9392	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:04	SLDVKPSNM	0.9	0.9392	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B42:02	DELIKPTSL	0.8544	0.654	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:08	DELIKPTSL	0.8187	0.726	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B14:03	SLDVKPSNM	0.8131	0.758	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:09	DELIKPTSL	0.8117	0.5939	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:03	SLDVKPSNM	0.7307	0.9728	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:12	DELIKPTSL	0.6959	0.9336	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B51:07	DELIKPTSL	0.6779	0.6254	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:05	DELIKPTSL	0.6723	0.899	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:15	SLDVKPSNML	0.9999	0.9775	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:09	SLDVKPSNML	0.9999	0.9256	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:07	SLDVKPSNML	0.8925	0.7024	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:10	LLDELIKPTSL	1	0.7811	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:09	SLDVKPSNMLV	1	0.9596	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:09	LLDELIKPTSL	1	0.8839	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:07	LLDELIKPTSL	1	0.7893	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:15	LLDELIKPTSL	1	0.9736	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:07	LLDELIKPTSL	0.9977	0.6633	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:01	LLDELIKPTSL	0.9976	0.6922	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:01	SLDVKPSNMLV	0.9913	0.8228	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:07	SLDVKPSNMLV	0.9907	0.8202	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:18	ELIKPTSL	0.9982	0.7278	6	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:12	ELIKPTSL	0.9711	0.8371	6	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:03	SLDVKPSNM	0.9999	0.8253	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C01:03	SLDVKPSNM	0.9999	0.9298	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:02	SLDVKPSNM	0.9999	0.9646	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C18:01	SLDVKPSNM	0.9999	0.7886	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:01	SLDVKPSNM	0.9999	0.7729	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:01	SLDVKPSNM	0.9999	0.91	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C01:02	SLDVKPSNM	0.9998	0.9474	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:04	DELIKPTSL	0.9943	0.9261	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:07	DELIKPTSL	0.9919	0.8677	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:05	DELIKPTSL	0.9897	0.9166	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B40:04	DELIKPTSL	0.9894	0.6435	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:08	DELIKPTSL	0.9887	0.8629	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:06	DELIKPTSL	0.9865	0.9321	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:03	DELIKPTSL	0.9812	0.9097	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:04	SLDVKPSNM	0.9189	0.8829	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C17:01	SLDVKPSNM	0.8621	0.9127	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:12	DELIKPTSL	0.8385	0.7384	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C07:04	SLDVKPSNM	0.8376	0.9362	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B18:11	DELIKPTSL	0.8332	0.8537	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B41:03	DELIKPTSL	0.8149	0.5149	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:31	DELIKPTSL	0.7549	0.9225	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:11	DELIKPTSL	0.7546	0.6893	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B39:02	DELIKPTSL	0.7478	0.9208	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:01	SLDVKPSNM	0.7307	0.9728	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:18	DELIKPTSL	0.7061	0.6673	5	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B07:13	SLDVKPSNM	0.3843	0.8414	12	21
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:02	SLDVKPSNML	0.9999	0.9775	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:01	SLDVKPSNML	0.9999	0.9256	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:03	SLDVKPSNML	0.9999	0.8988	12	22
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C08:02	LLDELIKPTSL	1	0.9736	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C18:01	LLDELIKPTSL	1	0.7699	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:01	LLDELIKPTSL	1	0.7893	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C04:03	LLDELIKPTSL	1	0.8166	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:01	LLDELIKPTSL	1	0.8839	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-C05:01	SLDVKPSNMLV	1	0.9596	12	23
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-A02:14	LLDELIKPTSL	0.9936	0.7097	3	14
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	617	HLA-B08:12	LLDELIKPTSL	0.9929	0.9158	3	14

Top

Potential FusionNeoAntigen Information of PIAS1-MAP2K5 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PIAS1-MAP2K5

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1901	ELIKPTSLDVKPSN	PIAS1	MAP2K5	chr15	68379088	chr15	67984817	617

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PIAS1-MAP2K5

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1901	ELIKPTSLDVKPSN	-7.15543	-7.26883
HLA-B14:02	3BVN	1901	ELIKPTSLDVKPSN	-4.77435	-5.80965
HLA-B52:01	3W39	1901	ELIKPTSLDVKPSN	-6.80875	-6.92215
HLA-B52:01	3W39	1901	ELIKPTSLDVKPSN	-4.20386	-5.23916
HLA-A11:01	4UQ2	1901	ELIKPTSLDVKPSN	-7.5194	-8.5547
HLA-A11:01	4UQ2	1901	ELIKPTSLDVKPSN	-6.9601	-7.0735
HLA-A24:02	5HGA	1901	ELIKPTSLDVKPSN	-7.52403	-7.63743
HLA-A24:02	5HGA	1901	ELIKPTSLDVKPSN	-5.82433	-6.85963
HLA-B27:05	6PYJ	1901	ELIKPTSLDVKPSN	-3.28285	-4.31815
HLA-B44:05	3DX8	1901	ELIKPTSLDVKPSN	-5.91172	-6.94702
HLA-B44:05	3DX8	1901	ELIKPTSLDVKPSN	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of PIAS1-MAP2K5

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	12	21	SLDVKPSNM	TAGACGTGAAGCCCTCCAATATGCTAG
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	12	22	SLDVKPSNML	TAGACGTGAAGCCCTCCAATATGCTAGTAA
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	12	23	SLDVKPSNMLV	TAGACGTGAAGCCCTCCAATATGCTAGTAAACA
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	3	14	LLDELIKPTSL	TGGATGAACTGATAAAACCCACCAGTCTAGACG
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	5	14	DELIKPTSL	AACTGATAAAACCCACCAGTCTAGACG
PIAS1-MAP2K5	chr15	68379088	chr15	67984817	6	14	ELIKPTSL	TGATAAAACCCACCAGTCTAGACG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PIAS1-MAP2K5

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
CESC	PIAS1-MAP2K5	chr15	68379088	ENST00000249636	chr15	67984817	ENST00000178640	TCGA-RA-A741-01A

Top

Potential target of CAR-T therapy development for PIAS1-MAP2K5

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PIAS1-MAP2K5

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PIAS1-MAP2K5

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)